Problemas de Bomba de agua

Problemas destacados

Se calienta a pesar qe le cambie bomba de agua qite termostato cambie

Volkswagen Pointer 2001 vw pointer  200000 kms
Mi auto se sigue calentando. , y ya le cambie bomba de agua, quite termostatoqe va debajo de la bomba de agua, puse abanico directo, cambie anticonjelante!!!!
Alguien me puede ayudar?????
el moco de México hace 5 años  
espayduck de México hace 4 años
Yo tenia ese mismo problema cambie bulbos, bomba de agua mangueras abrazaderas radiador, termostato y se seguia calentando lo apagaba y encendia aguantaba 10 minutos y se volvia a calentar. Hasta que en un foro lei que alguien con un problema similar le puso un cable del #12 que va de la cabeza del motor a hacer tierra en el chasis de la salpicadera, sorprendentemente al hacer eso mi falla se corrigio el problema es que la tierra que viene de fabrica es muy delgada y ya estaba podrida y no hacia bien su trabajo desde ese momento ya no tengo falla de calentamiento.
Jose de México hace 2 meses
Me puedes mandar foto de donde va la tierra
Mr. eduard de México hace 4 años
Es exactamente lo que le pasa a mi pointer 2003, jamas imagine lo de el cable de tierra, voy a hacer lo mismo porque ya me esta saliendo mas caro el mantenimiento que lo que me costo, gracias. Mr eduard.
Sr.brito de México hace un año
Tengo un pointer station 2001 se calienta mucho y no puedo ver la temperatura xque es digital mi indicador de temperatura cuando se sobre calienta enciende una luz en forma de temperatura. Ya le quite termostato y lo he llevado con varios mecanicos. Y me dicen que mientras el ventilador y la bomba de agua este funcionando es normal. Pero para mi no xq si se calienta demasiado. Y si le funciona todo el ventilador entra y la bomba de agua funciona. Pero al abrir el capo se siente el calor extremo del motor y no puedo ni tocarlo xq quema. Ya cheque aceite y no tiene agua x si se fuera la juntas
Hugo de México hace 7 meses
Es una porqueria tengo la misma falla y ya cambie todo el sistema de enfriamiento

Cambie bomba de agua y me regresa el agua por el deposito

Volkswagen Pointer 2002 wolfsburg 235900 kms
Buenas tardes todo empezó así empezó a escuchar un ruido en el carro al verificarlo era la bomba del agua que se descompuso del balero q llevan y ps bailaba la banda pero no se calantaba, total que compre la bomba nueva la puse y adiós ruido pero luego me fije que la temp subió a 90 y nunca prendió el abanico como normalmente lo hacia y empezó a tirar el agua por el deposito hirviendo, le quite el termostato para ver si acaso era eso pero igual luego quite una manguera de las que va al motor y me di cuenta que no esta circulando el agua hacia el motor por favor si alguien sabe que tiene me ayudarían mucho sus consejos. Gracias
marcp de México hace 4 años  
publico de México hace 4 años
Ya lo purgaste ??? tienen un tornillo que se afloja para que deje salir el aire del motor y la bomba pueda operar correctamente
churra de México hace 4 años
El deposito recuperador lleva una manguerita en la parte de arriba ahi recircula el agua del motor esa viene del radiador quitala del deposito y verifica que salga agua a veces se tapa y el carro se calienta mucho, quizas algun pedacillo de silicon del que usaron para poner la bomba se safo y termino tapando la manguerilla. Saludos

Porque a mi pointer le sale agua por la polea de la bomba de agua

Volkswagen Pointer 2001 4puertas motor 1.8 180000 kms
Buenas tardes lo que pasa es que mi pointer lo prendo y empieza aventar agua por el balero de la polea de la bomba de agua y tambien por la manguera que va al radiador y quiero saber si es la bomba que ya no sirve gracias por su atencion
Luis baez de México hace 2 años  
chango de México hace 2 años
Ya no sirve la bomba de agua, el motor se calienta y fuga presión por la manguera

Bomba de agua

Volkswagen Pointer 2003 4 puertas, 1.8 200000 kms
Hola amigos, les comento el dia de ayer hice un trayecto de aprox 30 min a una plaza, al llegar al estacionamiento de la misma me di cuenta de que comenzo a tirar todo el anticongelante, crei que era el radiador, pero si funciona bien, revise las mangueras al parecer no tienen fugas, al destapar el deposito del anti, se cae todo el agua por la polea de la bomba del agua, supongo yo entonces q es la bomba, el coche lo lleve empujando y lo deje en casa de un primo pues ya no encontre mecanico, tengo 2 meses q lo compre, ustedes que piensan q sea la falla?? mañana pienso cambiar la bomba.
hector de México hace 2 años  
Escalante de México hace 2 años
Cambia todo el kit para que te quites de dudas
joey75 de México hace 2 años
Has checado que entre tu ventilador en tiempo? Cuando el refrigerante llega a cierta temperatura (más de los 90°) bota el refrigerante, bien bien de donde lo tira?
alejandro de México hace 2 años
Me pasa lo mismo que hector solo q mi bomba gotea de apoco el anticongelante y conforme sube la temperatura lo habienta de chorro todo el anticongelante

Pointer se calienta por fuga en la zona de la bomba de agua

Volkswagen Pointer 2003 City 2 puertas, 1.8 lts. s/aa s/dh 89500 kms
Hola, mi Pointer se me calentó despues de andar un tramo de aprox. 10 kms., al parecer el ventilador está entrando normal, y al detenerme observé que está tirando el anticongelante en donde embona la manguera que va del radiador a la toma y bomba de agua. Ya no lo volvi a prender y me asistió una grua, al llegar a casa le quite la manguera en la que vi la fuga y no la encontré ni rota ni con fisuras incluso hice la prueba de llenarla de agua y no tiene ninguna fuga. Al volverla a colocar y rellenar de agua el deposito lo sigue tirando (apagado el coche). Me podrían decir por favor si es comun que haya fugas en la toma o en la bomba de agua? O bien, a que otra cosa se puede deber la falla de mi pointer? Muchas gracias por su ayuda.
Moctezuma84 de México hace 3 años  
ebarron de México hace 3 años
El goteo puede provenir de otro lugar de la misma manguera y por gravedad se va a la punta... es imposible checar una manguera solo hechandole agua,,,, la bomba ejerce presion y la temperatura debe oscilar entre los 80 y 97 °c. Lo mas barato es que cambies la manguera nueva para probar y si no queda es que tu bomba esta fracturada (la base), saludos
Moctezuma84 de México hace 3 años
Gracias por tus comentarios, resultó ser la toma de agua que estaba agrietada, pandeada y ya no sellaba bien, por ahí era la fuga. De todos modos gracias por la ayuda.
Leonardo de México hace 3 años
Mi hermano, mientras no elimines las fugas no vas a dejar de tener problemas de calentamiento, tu ya tienes identificada la fuga solo eliminala.

Se me descompuso la bomba del agua

Volkswagen Pointer 2005 4 puertas city 1.8 196000 kms
Buen platico un a mañana prendi el carro y sonaba raro me acerque al motor y note que la bomba de agua hacia mucho ruido y tiraba agua la cambiaron y cuando recorri unos km. el carro se quería apagar en los semáforos y tenia que acelerar decidi que le cambiaran también la banda de distribución porque al mecanico se le aflojo y la apretó y no me dio confianza después se seguía queriendo apagar y después de un rato de estar prendido estaba estable y luego se jalonea el motor y vuelve a estar estable y se vuelve a jalonear el mecanico sugirió q le cambiara filtro de aire limpio bujías cambio tapa… Leer completa
arturo de México hace 3 años  
fernando hdz de México hace 3 años
Mi carro tiene fuga de agua en una de las poleas tiene compustura o cambiar la pieza
Jorge de México hace 3 años
Ten cuidado ya que cuando se cambia la bomba de agua se tiene que poner a tiempo otra vez el carro y tensar bien la banda de engranaje, ami me da que tu mecani coo no hizo bien el trabajo. Verifica el tiempo y la banda se puede desbielar.

Bomba del agua

Volkswagen Pointer 2008 4puertas 20000 kms
Tengo un problema con la bomba del agua hace 6 meses la cambie y hace dos meses l puse otra y ultimamente boy a cambiarla me pueden ayudar gracias
juan de México hace 2 años  
alejandro de México hace 2 años
Hola Juan yo tengo un pointer 2003 tambien le cambiare la bomba del agua ya que esta tirando todo el anticongelate por hay

Cambie la bomba del agua

Volkswagen Pointer 2005 City 4 puertas con aire acondicionado 75000 kms
Andaba tirando poca agua despues fue mucha y vi q tiraba por la bomba del agua y la cambie y no quiere prender no le puse el termostato sera por eso
ARTUR de México hace 4 años  
Rafa de México hace 4 años
Al mio le sucedia lo mismo, le kambie el radiador y una pieza (creo es buje aunque no estoy seguro) ke konecta la manguera del deposito de anticongelante al radiador y se soluciono. El mio tampoco trae termostato, aunque el mio no dejo de encender

No funciona la bomba de agua

Volkswagen Pointer 2003 City 200000 kms
El carro se calienta y funciona muy bien en cuanto el ventilador todo pero al quitar una manguera me percaté de que no tiene presión la bomba ya la baje y revise incluso la lleve con un mecánico y me dice que está bien la limpié y la monte bien y la falla es la misma, y como no tengo mucho tiempo con el carro me comentaron que está nueva la bomba y ahora no se que hacer
Erick de México hace 2 años  
gabriel de México hace 2 años
Bueno puede ser 2 cosas la primera que tu termostato este fallando o que tu motor tenga aire y no deje circular el agua como debe, enciende el motor y cuando este un poco caliente la manguera gruesa del agua que va del motor al radiador aprieta fuerte varias veces y veras como sacara burbujas en el deposito y asi repite la operacion varias veces hasta que deje de sacar burbujas amigo saludos 5541024619

Calentamiento SolucionadoSolucionado

Volkswagen Pointer 2001 station wagon 1.8 electrica aire acondicionado 97000 kms
Para comenzar el cambie el radiador es nuevo, la bobina nueva, la bomba de agua es nueva, bulbo de temperatura del radiador nuevo, sensores de temperatura nuevos que van junto al motor arriba de la brida, se le cambio la banda de distribución, se le puso el termóstato nuevo, mangueras de enfriamiento nuevas. Cuando se llega a sobre calentar, le he cambiado el bulbo del radiador y trabaja bien, enciende a los 90º trabaja cerca de 2 minutos, descansa un poco mas de 1 minuto y vuelve a encender Y así esta por casi una semana, en este lapso no se consume el agua o anticongelante del deposito, por… Leer completa
cpgerry de México hace 3 años  
ebarron de México hace 3 años
Amigo... buenas tardes. Es una lastima que la hayas metido AGUA... ya que la misma hierve a los 100°c, ponle anticongelante que tiene un punto de ebullicion de hasta 127% si es PRESTONE concentrado 97% mucho mejor... y por favor !!!!PURGA EL SISTEMA!! como purgar??? facilicimo... quita la tapa/rosca del deposito del anticongelante desconecta con ayuda de unas pinzas la manguera mas delgada... y tapa con tu dedo para que no se te fugue el liquido... manten la manguera hacia arriba y ahora sopla en el deposito... cuando deje de salir aire y salga solo liquido ha quedado purgado!!
David de México hace 4 meses
Disculpa se quita la manguera q va en el depósito o la q va en el radiador. ??
ebarron de México hace 4 meses
La de entrada al deposito
alejandro de México hace un mes
Que tal se purga con motor encendido o apagado?
ebarron de México hace un mes
Prendido para que funcione la bomba. Saludos
Mejor respuesta (según cpgerry)
cpgerry de México hace 3 años
Muchas gracias!! por su apoyo, les comentare que revisando todo lo que me sugirieron, llegamos a la conclusión de abrir el motor
Quitaron la tapa de punterías, llegamos hasta la cabeza de motor, resulta que tanto los conductos donde pasa el anticongelante como la junta de cabeza de motor, ya estaban algunos tapados por el sarro y oxido y como no circulaba el anticongelante se calentaba seguido, mas en las subidas. Si alguien gusta les puedo mandar las fotos, a fin de que puedan tomar una mejor decisión, yo compraba cada 8 días el bulbo que va abajo del radiador, pero se tronaba y ya no era normal y tome la decisión de hacer la reparación.
tonylga de México hace un año
Sirven los likidos anticorroaivos ke se le hechan y ke remueven el sarro y oxido amogo?
Ernesto de México hace un año
Buenas noches me puedes mandar las fotos que comentas
Carlos Trejo de México hace un año
Por favor envíeme fotos de las los lugares que tenía sarro el motor y que tuvieron que destapar. Tuvo que bajar el motor??
Pepe Bonilla de México hace 10 meses
Me podrías mandar las fotos por favor, gracias.
Abdiel M de México hace 7 meses
Me podrías mandar las fotos ,para verificar en donde se acumula el sarro
Josue de México hace 6 meses
Qué tal Buenas noches Yo tengo un Pointer 2001 y también me pasa lo mismo me podrías mandar las fotos gracias
cpgerry de México hace 6 meses
Estas son las fotos del motor de la pointer
Josue de México hace 6 meses
Ok muchas gracias por las fotos
ebarron de México hace 3 años
Ese Sarro y Oxido que comentas fue provocado por hecharle agua... en lugar de anticongelante... que nos sirva de experiencia a todos los que ven el foro.
Giovanni G de México hace 3 años
Hola me puedes mandar las fotos que comentas por favor
Oscar de México hace 3 años
Hola yo tambien te agradeceria mucho si me mandas fotos Saludos
Armando de México hace 3 años
Yo tambien quisiera las fotos, si no es mucha molestia.
mario de México hace 2 años
Que tal me interesan las fotos y si es posible saber el costo de la reparación, gracias gracias
Eder de México hace 2 años
Mandame fotos de la reparacion de tu motor
samy de México hace 2 años
Tambien a mi me podrias mandar las fotos
miguel de México hace 2 años
Amigo saludos yo tengo un pointer mod 2004 y me pasa lo mismo mandame las fotos xfa a
mozta de México hace un año
Me podrás mandar las fotos de como purgar
rich de México hace un año
Hola mi pointer no se calienta ni nada solo gasta el anticongelate q sera??
ebarron de México hace un año
Una Fuga...
Daniel murillo de México hace un año
Una molestia tengo un pointer 2000 ya le cambie termostato,bomba de agua,radiador y el bulbo del radiador pero el problema que tiene es que se calienta pero te detienes con el motor prendido y la temperatura se baja otra ves a los 90 grados
ebarron de México hace un año
Hola Daniel, quiero entender que la temperatura en RALENTI es normal, solo incrementa cuando lo aceleras o avanzas. Correcto? hagamos una prueba a distancia que no te costará un solo centavo. Prende el carro y deja que llegue a los 90 grados, metete por debajo del auto a la altura del radiador y encontraras una maguera gorda... con cuidado trata de apachurrarla (ojo con los dedos debería estar caliente). Dime si está fria ? Si está fria tienes un problema de circulacion de fluido y solo hay 2 causas (bomba o termostato). El termostato tu lo cambiaste?? te fijaste que fuera de los mismos grados que el que quitaste?? COn gusto te ayudo pero, paso por paso ok? retroalimentame sobre este diagnostico para en su caso pasar a los que siguen ok? Saludos
Daniel murillo de México hace un año
Si yo selos cambie esque soy tecnico mecanico yo le meti termostato oorque no tenia el ventilador si prende bien y todo pero si tenia un problema por eso porque dejaban de trabajar pero ahora el problema es que aun asi trabaje el ventilador se calienta caminandolo y se enfria parado ese es mi problema
ebarron de México hace un año
Comienza por revisar lo que comenté y luego vamos con tu catalizador. Saludos
Alfredo m de México hace un año
Yo me pasaba lo mismo primero cambie toma de agua, luego donde va el termostato funcionaba bien una semana a dos meses y otra vez volvía a tirar el anticongelante por el deposito y la falla era que dónde se conecta el ventilador tenia un falso y cuando se movía no entraba el ventilador lo lije un poco y ya no me volvió a dar lata
Daniel murillo de México hace un año
Gracias alfreso pero ya le encontre la solucion fue el ventilador que tenia la polaridad alreves jejeje
Eduardo de México hace un año
Y como descubriste la polaridad? Tengo el mismo problema q el tuyo ya tiene sensores nuevos , bomba de agua nueva y mangueras ,el ventilador si prende me baja a 90 y después prende otra vez pero cuando ya va en 110
Daniel murillo de México hace un año
Porque el ventilador jiraba alreves jiraba asia el radiador y no asia el motor
Eduardo de México hace un año
Y como lo acomodaste ?
Daniel murillo de México hace un año
Solo corte e intercambie los cables del enchufe lo que estaba mal era eso el enchufe como no era el original por eso fallo el carro intercambia el enchufe y si gira asia el motor ya quedo bien
Eduardo de México hace un año
Ok gracias bro aunque dudo como se habrá intercambiado el giro xq no e remplazado cable :l
Dani 0885 de México hace un año
Amigo me podrías ayudar ?
Rigo de México hace 3 meses
Y si no tiene termostato y se sigue calentando que puedo hacer
cpgerry de México hace 3 meses
El radiador debe de llevar un bulbo
Dani 0885 de México hace un año
Hola amigos yo tengo un problema de calentamiento mi pointer es 2004 ya le cambie bomba de agua, ya cambie termostato por uno de la misma temperatura, los ventiladores entran a 95°,cambie los dos bulbos de la brida y el radiador es sin bulbo, el radiador lo compre hace 1 año ya hasta cambie la cabeza completa, y en subidas se calienta y cascabelea demasiado y poniendo el aire acondisionado se calienta mas alguien me puede ayudar ya estoy desesperado y gastado mucho 😢
ebarron de México hace un año
Lo unico que queda es revisar la tapa del deposito del anticongelante base de la bomba del agua y el catalizador. Suerte.
Victor de México hace 3 meses
El catalizador tiene relacion con el calentamiento del motor yo los estoy leyendo porque mi pointer abeses no se apaga el ventilador y noto como si no sirculara bien el agua de echo desconecto la manguera mas pequeña que tiene el deposito y no sale nada solo si la bajo tira anticongelante pero a la altura que esta el deposito no sale nada esto ocurre con el motor andando
ebarron de México hace 3 meses
Hola, claro... un catalizador tapado puede llegar a calentar tanto un carro que ha llegado a torcer la cabeza o a desbielarlo, en tu caso te recomiento que Purgues perfectamente el sistema, ya que al desconectar la manguera que indicas lo unico que estas provocando es mas falla permitiendo que las lineas se llenen de aire. Una mala circulacion de anticongelante es señal de que 1. - la bomba de agua está muy cansada, 2. - el termostato ya esta por fallar o 3 tienes que sondear las lineas y radiador. (caso extremo). Saludos.
ebarron de México hace un año
Tambien checa que el ventilador esté dando las vueltas correctas (RPM) si no es suficiente, no alcanza a enfriar el auto. Saludos
Pachis de México hace un año
Amigos me podrán ayudar? Mi pointer modelo 2000 vagoneta le dieron servicio al cabezote y cambiaron los anillos el mecánico me dijo que lo manejará máximo a 60km. X hora máximo durante unos 2000 kilómetros mientras acientan bien los anillos pero ahora veo que llevo recorridos 1300km. PERO VEO QUE SE CALIENTA EL CARRO ya el mecánico cambio los bulbos de temperatura ventilador nuevo y nada más lo que NO cambio el mecánico es el termostato ni bomba del agua que puedo hacer ayuda amigos estoy desesperandome mil gracia
ebarron de México hace un año
Se calienta? es un termino muy amplio... te pido seas mas especifico. Ahora bien... dejalo andando y toca la manguera gruesa que va debajo del auto (al radiador), esta fria?? si está fria tu problema es circulación de anticongelante, para lo cual hay que revisar PRIMERO QUE ESTE ´PURGADO EL SISTEMA Y SEGUNDO TERMOSTATO Y BOMBA.
Uliabu de México hace un año
Tengo el mismo problema me puedes mandar las fotos el mío es Pointer 2002 ya le cambiaron bomba de agua, termostato, bulbos, manguera, cepillado de cabeza.
haydee de México hace 10 meses
Hola mi carro se calienta estando en marcha cuando el ventilador se apaga baja la temperatura es un pointer 2000 le cambiaron la bomba de agua sensor de temperatura y finalmente Rectificaron la cabeza 2 semanas estuvo bien y se comenzó a calentar nuevamente ya no se que hacer me pueden ayudar
Daniel murillo de México hace 10 meses
Ponle un marcador externo para saber si no es el tablero
Pepe Bonilla de México hace 9 meses
Me podrías mandar por favor las fotos de los conductos tapados de sarro por favor y si pudieras darme mas información de como le removieron el sarro, gracias, tengo el mismo problema y ya me siento cansado de esta lata que nunca me había dado
cpgerry de México hace 18 días
Estas son las fotos, epero te sirvan!
Pepe Bonilla de México hace 9 meses
Perdón mi correo es
Cristian mtz de México hace 8 meses
Tengo un pointer 2001
Ya le cambie radiador, bomba, manguera, ventilador y se sigue calentando cuando se calienta lo apago y lo prendo y se baja la temperatura que pudiera ser
ebarron de México hace 8 meses
Hola. Revisa tu bulbo de temperatura.
Diego Jiménez de México hace 7 meses
A mí se me calentaba igual , hasta que descubrí que el tubo que lleva de la bomba a la calefacción estaba súper oxidado por dentro lo cual soltaba muchas impurezas y esto me tapaba el radiador y el de la calefacción y no dejaba circular el agua, baje el radiador y trate de meterle agua a presión y le salió mucha tierra con errumbre
Esteban garcia de México hace 7 meses
Me podrias mandar las fotos
Gracias un saludo
cpgerry de México hace 7 meses
Listo amigos, espero les sean de utilidad
José Juan Valadez de México hace 6 meses
Hola buen día, mi pointer es modelo 2000 wagoner, hace 3 semanas se viene calentando, es decir, comencé a notar que la aguja de la temperatura subía hasta que se encendía el foco de temperatura, el ventilador se quedaba prendido durante todo mi traslado, y en ocasiones no prende y es cuando sube la aguja de la temperatura. Ya me lo purgaron, me le cambiaron el bulbo del radiador, me le cambiaron el sensor, le cambiaron la bomba de agua y sigue igual, yo no soy mecánico y veo que los mecánicos donde llevé mi carro no saben que tiene, temo seguir gastando en piezas que a lo mejor no necesitan cambio. Cabe mencionar que no tiene termostato. Saludos y ojalá me ayuden.
cpgerry de México hace 6 meses
Tienen q abrir el motor hasta la cabeza del motor, ya que seguramente tiene tapados los ductos del anticongelante
José Juan Valadez de México hace 6 meses
Muchas gracias por su respuesta cpgerry, le diré eso al mecánico. Saludos
ebarron de México hace 6 meses
Lo de la cabeza del motor es la ultima instancia, antes hay que hacer un diagnostico sencillo y con gusto te voy llevando paso a paso.
Hecha a andar el auto, espera a que llegue a la temperatura que accione el ventilador, metete debajo del lado del radiador y CON CUIDADO toca la manguera gorda, esta fria? caliente? apachurrala, esta aguada o dura...?? quedo pendiente de tus comentarios.
hector de México hace 3 meses
Discula si queda un poco aguada que debe de ser
ebarron de México hace 3 meses
Hola, primero cambia tu termostato, ojo quitalo y que te den uno IGUAL, es decir, de las mismas caracteristicas, dicho termostato traerá tatuada la temperatura de acción, checa que sea la misma, Por favor no compres refacciones CHAFAS, trata de buscar el termostato original, en la CALIFORNIA no hay BUENAS REFACCIONES, hay refacciones economicas, te recomiendo AUTOZONE o refaccionarias que venden piezas originales. Saludos
Girosintornillos de Argentina hace 6 meses
Hola ebarron, tengo un problema con el sensor map de mi pointer gli 1.8i motor audi, noté que el anterior (lo cambié por uno nuevo) me arrojaba una señal permanente sin oscilación al poner el motor en marcha, igualmente hace lo mismo el nuevo map. ¿por qué sucede esto? evidentemente algo falla y la marcha dá las características de ser un problema de ese sensor, tiende a ahogarse, consume muchísimo y tira humo negro por el escape, además larga un fuerte olor a mala combustión. Lo compré hace dos meses, ya le cambié tps, iac y arneses (originales magneti marelli) bujías, cables , tapa distribuidor, cambié correas totales (distribución y accesorias) rectifiqué tapa cilindros con guías y válvulas nuevas, manguera nueva desde el map al múltiple de admisión.
cpgerry de México hace 6 meses
Asi lo solucione yo espero TE sea de utilidad
gonzalo mendoza v de México hace un mes
Asi estaba mi pointer y mande a un laboratorio a lavar el riel de inyectores con todo y los inyectores y santo remedio dejo de gastar gasolina y sacar humo negro
alejandro vazquez de México hace 5 meses
Amigos me pueden ayudar tengo un pointer 2000 se me calienta por que el ventilador se prende cuando quiere o aveces se queda prendido y tengo que apagar el carro y desconectar el ventilador y esperar un rato asta que se enfrié y es a si como se apaga el ventilador por no se apaga solo
cpgerry de México hace 5 meses
Esto le paso a mi pointer, y te mando las fotos
ebarron de México hace 5 meses
Alejandro Vazquez: Tu ventilador no es el problema, revisa el RELAY que esta por la zona de pedales, ya se queda pegado. Es de color anaranjado y metiendo tu cara a los pedales mira hacia arriba por la zona de fusibles abajo. Saludos
ebarron de México hace 5 meses
Girosintornillos: Me pregunto si ya revisaste la COMPUTADORA, y si la misma corresponde a tu motor GLI. Checala.
Carlos de Argentina hace 4 meses
Mi pointer en mi caso cuando voy en la ruta la temperatura llega a los 90 prende el electroventilador si voy 90 de velocidad y me paso de 100 por mas que este prendido el electro la temperatura sigue subiendo largo el acelerador y la temperatura baja
ebarron de México hace 4 meses
En tu caso hay que revisar todo el sistema, desde la bomba hasta la potencia actual del ventilador. Usas agua? o anticongelante?
Girosintornillos de Argentina hace 4 meses
Hola, anticongelante, siempre.
ebarron de México hace 3 meses
Es sistema de enfriamiento del pointer es bueno, pero hay que tenerle pasciencia. Comencemos por que cheques mis comentarios acerca del diagnostico (apretando mangueras con la mano) y de ahi te voy llevando. Si quieren pueden buscarme en mi correo, saludos.
angel garcia de México hace 3 meses
Porque oos vw pointer no traen un rango de temperatura en el tablero en el caso mio es 2007 y no le veo algun rango de tamperatura que me indique que se me esta calentando y hace dias limpie el sistema de refrigeracion por tener oxido y ya quedo limpio al momento de hecharle el refrigerante prendi el carro y lo acelere hechandole refrigerante para que bajara y si baja el refrigerante solo que cuando baja sale como vapor estando el tapon del recuperador quitado y se le oyo adentro del recuperador como si trajera burbuja como si fuera una oya irviendo mi duda es si esto es normal o que onda porque muchos me dicen que este sistema de mi pointer no se pourga y otros que con el deposito abierto con el carro prendido para que sircule el refrigerante a todo el sistema de refrigeracion y que entren los avanicos tiene y si entran los avanicos solo que me queda duda eso de la purga y ay quienes me dijeron que con quitar la manguera de arriba del recuperador y soplarle agarrando la manguera para ver el aire que sale por la manguera con eso tiene pero pues sigue circulando el refrigerante y hace presion de aire no pues miren no que onda que me aconsejan soy mecanico pero esto para mi fue algo nuevo si ay que purgar diganme si algo hice que quedo mal mas vale preguntar que cometer un grave error y en lo personal mi carro hoy en dia no me ha fallado para nada ni se me a calentado pero sigo con esa duda de que si hay que purgar o no cual seria su opinion
ebarron de México hace 3 meses
Hola, en primer lugar me preocupa el OXIDO que comentas, ya que el mismo solo es ocasionado por meterle AGUA, hay que ver que mas está dañado o corroído. En cuanto a tu duda, es correcto, los modelos AUSTEROS no traen aguja gradual, en mi caso yo si purgaba mi sistema, y te diré como lo hago YO... (con el carro andando), del deposito de anticongelante quita la tapa azul y desconecta la manguera delgada de arriba y con tu mano jálala hasta la boca del deposito cuando dejes de escuchar que fluye aire o burbujas y solo circule anticongelante el sistema ha quedado purgado... conecta y tapa (solo al llegue). Esto último es vital, si aprietas mucho la tapa con el deposito caliente despues NO LO VAS A PODER ABRIR, el plastico de dilata y cuando se enfría... uffff. Para que te cuento...
Marco Trejo de México hace 19 días
Buenas tardes, a mi auto corsa 2005, le pongo solamente agua le puedo poner anticongelante sin diluir en el radiador sin drenar el agua??, esto lo comento porque leí la información de que un auto requiere anticongelante y el tapón de drenado del radiador esta casí soldado al mismo y si lo retiro a la fuerza se valla a romper la base del radiador. Agradeceré sus comentarios porque no tengo dinero para comprar un radiador nuevo.
ebarron de México hace 19 días
Este foro es de pointer amigo, busca la marca y modelo de tu auto.
Marco Trejo de México hace 19 días
Gracias lo voy a buscar
E. VICTORINO GONZALEZ I. de México hace 17 días
sr. barron tengo pointer 2000 desde nuevo le pongo agua por que siempre lo tira, lleva 178 mil kilometros, le cambie el termostato y se sigue calentando a las 20 cuadras de circular, hoy le cambie nuevamente termostato y tapon del deposito espero solucionar el problema. Leo que puede ser el catalizador, recorro diario 10kilometros
ebarron de México hace 17 días
Ya te revisaron la bomba del agua?

Marca el testigo del aceite SolucionadoSolucionado

Volkswagen Pointer 2005 1.8 60000 kms
Hola a todos, espero me puedan ayudar, hace 1 mes se amarró el motor de mi auto y se mando rectificar el motor, cuando armaron todo y lo encienden todo bien estuvo un rato el coche prendido y se encendió el testigo del aceite se aceleraba y se apagaba un rato mas y ya no se apagó, se compró bomba de aceite nueva y ya no presentó la falla al encender pero de igual forma se aceleraba y se apagaba hasta que se nuevo se quedó prendida el filtro del aceite ya se había comprado y pensaron que estaba defectuoso compre otro y dejó de prender el testigo y se le cambió también el bulbo pensando que era… Leer completa
serch2612 de México hace 4 años  
Guadalupe Garcia de México hace 4 años
Saludos amigo, yo tengo un pointer 2002, es la version GTI, me hace la misma falla, cuando el motor calienta a la mitad comienza con la falla, al bajar a las 1000 revoluciones o menos se enciende la lamparita del aceite, aceleras y se apaga, y asi, yo ya cambié la bomba del aceite, 2 filtros, el bulbo (sensor) de aceite, rotor, cables de bujias, las bujias, afinación, se limpio la base del filtro de aceite y los conductos internos, y aún sigue la falla. Te agradeceria si consigues resolver el problema me lo comentes de igual manera yo te lo comento si consigo resolverlo. Gracias.
Necur de México hace un año
Cual fue el problema lo encontraron ??? Tengo el mismo problema
Guadalupe Garcia de México hace un año
Despues de haber hecho todo lo anterior y cerciorarme de que el problema no estaba en el motor, cambié los sensores de la temperatura del agua y asunto arreglado
brandon de México hace un año
Tengo el mismo problema con un pointer 2009 version gt, muchas gracias realizare el cambio de sensores de temperatura del agua ¡
Cova de México hace un año
Tengo la solución, me pasó el mismo problema, no subía el aceite a la cabeza y está sonaba por falta de lubricación, se encendía la luz de baja presión de aceite como al minuto de encender en frío, una vez caliente se caía la presión, a continuación listare lo que se hizo sin solución:
Se remplazo bomba de aceite
Se remplazo bulbo de aceite
Se remplazo base de filtro y filtro de aceite
Se quitó la cabeza para limpieza

La solución fue poner una línea de bypass ósea se metió la presión directamente a la cabeza, esto corrigió el problema la presión llega a la cabeza y la lubricación llega y el ruido se detuvo. La corrección tuvo un costo de al rededor de 700$ pesos ocupando una manguera de alta presión de 1/4 y algunos milpea y conexiones. Espero que les sirva saludos.
Hams de México hace 4 meses
Le hice lo del bypass y quedó muy bien, el mío es Un pointer 2006. Gracias
Cova de México hace 4 meses
Que bueno que te sirvió la solución, saludos
Jonas de México hace 4 meses
Amigos tengo el mismo problema. Ya hasta le repare el motor completo y el carro sigue igual! Mañana lo are y les aviso si queda! Gracias
Hams de México hace 4 meses
Le pones una T a la manguera para que conecte el bulbo de aceite y siga operando el indicador del tablero, así le hice.
JJbaltazar de México hace 2 meses
Amigos, realice este cambio pero tengo un problema, en la salida Cova indica no le circula aceite a mi vehículo cuando esté llega a la temperatura de trabajo, ¿Alguien me podrá ayudar para identificar el problema? Ya estoy desesperado
gerardo de México hace 4 años
Mismo problema que los dos, si saben que puede ser tambien agradeceria que me lo hicieran saber. Mi correo es saludos.
serch2612 de México hace 4 años
Fui con otro Mecanico y me dijo que no estaba bien rectificado fui a ver a otra persona que rectifica motores y me dijo que si estaba bien que de seguro esta sucio el motor y que las venas no estan bien limpiadas por falta de tiempo no he podido llevar mi coche pero es la única solución que me han dado
maccelgand de México hace 3 años
Tengo el mismo problema que tu, ya lo resolviste? y si mi Block ya fue revisado
Ederht de México hace 3 años
Hola. Tuve el mismo problema, se cambio dos veces la bomba de aceite y nada. La tercera cambiamos metales del arbol de levas y asunto arreglado.
Toño de México hace 8 meses
Metales de arbol de levas??? En un pointer?? Donde que yo no se los vi
Mejor respuesta (según serch2612)
serch2612 de México hace 2 años
En el porta filtros del aceite hay un regulador se saco con llaves torx se limpio y asunto resuelto
Yahir Salinas de México hace 10 meses
Ese donde se encuentra?? no ubico
Jonas de México hace 4 meses
He escuchado eso amigo, donde lo ubico? Y como hay que hacerle para desarmar!
Ernesto de México hace 4 meses
En mi caso cambie toda la pieza con todo y regulador ya que no lo venden solo, y el problema siguió igual.
JJbaltazar de México hace 3 meses
Tengo el mismo problema con un Pointer 2007, se al llegar a la temperatura de trabajo y enciende el foco del aceite, y aún acelerando se mantiene encendido. Donde se localiza ese regulador del que hablan?
Le agradecería su ayuda
Alfredo S%C3%A1nchez Gra%C3%B1a de México hace un año
Hola Buenas tardes,

Tengo un jetta clásico 2010 le acaban de hacer servicio hace 2 semanas; al manejar en carretera todo marcha bien, sin embargo; al pasar de 100km/hr se enciende el foco de aceite, disminuyó la velocidad y se apaga. Hicimos parada para revisar y los niveles de aceite están bien, que podría ser???

Ayuda !!
Isai de México hace 5 meses
Hola tuve ese problema de que en bajas revoluciones me prendía el espía de aceite al acelerar se apagaba, me di a la tarea y vi muchos comentarios aquí, empece por cambiar el sensor de presión fui por el original y quedo resuelto!!!
rogelio de México hace 3 meses
Yo tambien tengo el mismo problema tengo un pointer 2001 se prende el foco de aceite pero muy apenas en cuando lo acelero y se a paga pero a parese despues
Isai de México hace 3 meses
Lo solucione cambiando el sensor de presion de aceite

Se eleva temperatura y no enciende el ventilador de radiador SolucionadoSolucionado

Volkswagen Pointer 1998 3 puertas 250000 kms
Mi caso es el siguiente: La temperatura del motor se incrementa luego de encenderlo y caminar por algunos 10 o 15 minutos, ya le cambie el bulbo de temperatura (se corrigió medición de temperatura), ya le cambié la bomba de agua, ya le busqué el termostato y al parecer este modelo no lo trae ni en la entrada ni salida del radiador, ya le cambie el sensor azul a la salida del motor y entrada del radiador. He notado que el motoventilador del radiador no opera, y si lo hace es por un corto periodo de tiempo (insuficiente para bajar temperatura). Me gustaría saber qué es lo que activa al motoventilador y por qué no circulael anticongelante en el circuito de enfriamiento, pues ya le he quitado la tapa del depósito y no se ve movimiento del mismo.
Fernando F de México hace 2 años  
ANGEL E. de México hace 2 años
Tu carro necesita hacer tierra pone un cable de algún tornillo de la caja de velocidades a la carrocería, me paso lo mismo con un pointer 2000
Fernando F de México hace 2 años
Que tal Ángel, gracias por el apunte ahora lo voy a considerar pues tiene sentido ya que algunas marcas manejan el GND como el retorno del relevador y en otras marcas lo hacen con e 12+ vcc...
carlos B de México hace 2 años
Hola Fernando, yo he estado batallando recientemente por lo mismo, el termostato lo debe de traer donde van los dos sensores pegados a la cabeza del motor, otra cosa que puedes probar es en los relay's que estan cerca de la central de carga, es un fusible naranja y uno gris, son los que mandan la señal para activar o desactivar el ventilador
Fernando F de México hace 2 años
Hola Carlos B que tal, le quite las mangueras del anticongelante que entran y salen del motor y no aparece el termostato, los fusibles ya los revise... sólo hace falta verificar el funcionamiento de los relevadores, sin embargo, pienso que ese no es el problema puesto que en ocasiones si entra en operación el motoventilador...
horcamedia de México hace 2 años
De los sensores de temperatura normalmente el de arriba (negro)mide la temperatura en el tablero y el de abajo (azul) es el de la temperatura si no son originales puedes tener problemas aparte checa que las lineas de los mismos esten bien aparte de esos bulbos el motoventilador arranca con un bulbo motoventilador que generalmente va a la salida del radiador
Mejor respuesta (según Fernando F)
Fernando F de México hace 2 años
Estoy convencido de que los sensores no son, pues ya los he reemplazado todos dos veces y continua la falla. En efecto, hay un bulbo que se encuentra en la parte inferior que parece un tornillo de 1" de diámetro de latón con dos pines para conectar el arnés que se supone envía la señal motoventilador...
Rickolarra de México hace 2 años
Yo tengo un pointer 2005 y el termostato lo trae en la toma de agua que viene del radiador. La que esta en la bomba de agua. Seguro se lo quitaron por eso no lo encuentras. La falta del termostato face que el ventilador haga las funciones de termostato y esto puede ocacionar problemas de logica en la programacion de la computadora y por eso muchas veces hace cosas raras. A mi me paso, le quitaron el termostato y prendia aleatoriamente. Tambien te recomiendo que cheques si tu pointer lleva resistencia en el ventilador. Normalmente esta resistencia se la quitan. Esta resistencia es la que te da la segunda velocidaddel motoventilador
Fernando F de México hace 2 años
Que tal Rickolarra, me parece buen aporte lo que me sugieres eso hace falta revisar. He notado que como bien dices la computadora hace cosas raras, le voy a conseguir el termostato. En cuanto a la resistencia del motoventilador, no es muy visible que digamos... serias tan amable de informarme donde está ubicada?
JCESAR de México hace 2 años
Camarada a mi me paso lo mismo de igual forma se me empezaba a calentar el carro y lo mismo con el ventilador la solucion que me dieron fue cambiar el bulbo del anticongelante y de igual forma calentarlo sin mover el carro y al mismo tiempo prender el aire acondicionado caliente, según el mecánico eso sirve para que se purgue y empiece a realizar sus funciones de forma normal, es una pieza metálica que parece un tapón de alguna tubería
Fernando F de México hace 2 años
Que tal Jcesar, ya le cambie dos veces el bulbo del radiador y si ha funcionado por un periodo no mayor a 2 meses y de nueva cuenta se repite la falla. Por otro lado, la versión que tengo es sin aire acondicionado por lo que no podre aplicarla como te informó el mecánico. Gracias
Leonardo lopez de México hace 9 meses
Que tal amigos tengo un pointer 1999
Tiene un problema al querer prenderlo da marcha pero no enciende creo que se ahoga después de un rato de intentar prenderlo enciende pero burron y en ocasiones petardea les agradezco su orientación
joatan de México hace 5 meses
Buen día amigos tengo problemas con mi camioneta pointer pick moja la bujía del pistón 3 cambien bujías y sigue asiendo lo mismo, puse en marcha el motor y fui quitanto cada cable de las bujias y note que la del pistón 3 no se quiso parar el motor como en las anteriores. Me quisieran ayudar profa para saber si es el cable de la bujía o tal vez tenga que revisar otra cosa. Gracias
Deportista de Estados Unidos hace 2 meses
Hola alguien me puede ayudar con el problema de mi carro es un chevy cavalier 98,el problema es que el ventilador no enciende cuando sube la aguja de temperatura ya le cambie el sensor de temperatura,la bomba de agua,el relevador,el termostato solo me falta comprar la computadora,es necesario comprarla?que me recomiendan hacer o es otra cosa que debo cambiar?

Fuga de anticongelante y sobrecalentamiento SolucionadoSolucionado

Volkswagen Pointer 2005 4 puertas  140000 kms
Desde hace algún tiempo también tengo el problema de fuga de liquido anticongelante y sobrecalentamiento, le cambie la bomba de agua, el termostato, algunas mangueras, el bulbo que va en la parte inferior del radiador y sin embargo el nivel disminuye diariamente por lo que le tengo que colocar nuevamente, en estos días me acaba de pasar lo que tu comentas del vapor en las rejillas del aire acondicionado incluso me empaño demasiado el parabrisas y detecte una fuga de agua en la parte baja de los controles del aire "debajo del tablero" por lo que espero solucionarlo y comentar mi situación a la brevedad.
Diego de México hace 4 años  
Skar de México hace 4 años
Pues puede parecer algo simple, pero la tapa del deposito del anticongelate puede ser un factor, checalo. Saludos.
Juan Manuel de México hace 4 años
Puede ser el "radiador" del aire acondicionado", a mi me pasó...a mi me lo desconectaron porque tenia que reponerse la pieza nueva y ya con mano de obra llegaba la cuenta a los 4mil o mas...saludos
Mejor respuesta (según Diego)
Diego de México hace 4 años
Gracias por sus comentarios, si era el radiador de la calefacción, se lo cancelaron en 150 pesos, el motor del ventilador también lo puse nuevo y además me recomendaron cambiarle el bulbo del ventilador por uno de Caribe debido a que manda la señal a una temperatura más baja y el ventilador entra más veces evitando que llegue a temperaturas mayores. Ya solucione ese problema, gracias
DAMIANRC de México hace 3 años
Comienza cambiando el tapón del depósito del anticongelante, los depósitos traen una válvula de seguridad, cuando no sella herméticamente el tapón se abre y libera vapor para evitar que explote, compra el tapón y ojalá con eso quede, a veces pensamos que tiene una fuga porque libera vapor pero en ocasiones eso indica que es el tapón.

Humo después de anillada SolucionadoSolucionado

Volkswagen Pointer 2005 4 puertas, motor 1.8, DH, AA 140000 kms
Es normal que un vehiculo arroje humo después de ser anillado, previamente hechaba humo cuando el motor estaba frío por las mañanas solamente, ahora lo hace más seguido. Sin embargo mejoró muchisimo después del trabajo, recuperó potencia y mejoró el consumo de combustible. Lo que se le cambió fué: anillos, todas las juntas, radiador, bomba de agua, banda de tiempo, las dos poleas tensoras, la cabeza se cepillo y se le dió mantenimiento completo y afinación completa. Lo que argumenta mi mecánico es que "tengo que caminar más el motor para que carbonice", hasta el día de hoy llevo 150 km y me preocupa que me cuestione alguna autoridad de tránsito o ecología. Les agradezco la orientación que puedan brindarme.
pepeara de México hace 4 años  
tony de México hace 4 años
Si es muy normal que heche humo y no te preocupes por el kilometraje como minimo debe ser 1000 kilómetros para que se acienten todas las partes de presicion y deje de humear.
Skin de México hace un año
Buenas noches tengo la duda
Mi pointer acaba de ser anulado y cambiaron válvulas y sellos. Sólo que note que volvió a echar humo azul. Sera normal o algo quedó mal?
Mejor respuesta (según pepeara)
pepeara de México hace un año
Hola. Después lo lleve con otro mecanico y me comentó que la cabeza no la habían reparado correctamente. Algo a así como que la cabeza es realmente para un 2 litros y le pusieron válvulas para uno de 1.8 litros. Después de que se reparó de esta forma todo quedo bien sin echar ningún humo.
MARY de México hace un año
Hace unos 2 meses me anillaron el carro, un pointer 2002, y todo muy bien pero hace unas 2 semanas empezo a echar mucho humo blanco y no se le kita y cuando acelero peor... alguien que me diga que pasaria? plis
pepeara de México hace un año
El problema del mecanico es que el hace el trabajo de desarmar y armar y de ahí no lo vas a mover. Mi problema radicó en que la rectificadora no hizo bien su trabajo. Yo lo lleve con otro mecanico y me lo dejo muy bien, sin necesidad de recorrer kilómetros para asentarlo, inclusive lo levanté a 160 km/h sin problemas y desde el kilómetro uno no sacó ningún humo.
Omar Gomez de México hace 4 meses
Hola a mi pointer 2005 le fallo la bomba de aceite y dejo de lubricar la cabeza lo que provoco que se amarrara el árbol de levas y se fastidiara la cabeza, compre una de uso según lista para montar, pero me comento el mecánico que al colocarla estaba amarrada, así que la lleve a la rectificadora, la montaron y ya arranco y me dijeron que lo anduviera trabajando 15 días y que se le tenia que cambiar el aceite debido a las rebabas ya que se le cambiaron anillos, metales, bomba de aceite etc. el problema es que tiene fallas se apaga, tiembla mucho y me esta consumiendo mucha gasolina ademas de que echa mucho humo y huele mucho a combustible, le moví un poco el tiempo y se corrigió un poco, pero a un así persiste la falla, ya no se lo quiero llevar al mismo mecánico ya que me dilato mas de un mes en entregármelo y me cobro demasiado ademas de que me cambio mi batería etc, lo que quiero saber es mas o menos cual es la falla para que al nuevo mecánico que se lo lleve no me vea de nuevo la cara por favor gracias y saludos.
oscar de México hace 4 meses
Buenas tardes, ami me paso algo exactamente le cambie bujias , tapa del sidtribuidor , lavado de inyectores , cables de bujias , rotor nuevo , y en subias se ahoga y gasta bastante gasolina , a que se devera mi falla , ayudenme con esa falla

Baja presión de aceite

Volkswagen Pointer 2002 5 puertas, city, 1.8 austero 145116 kms
El problema empezo una vez se me calento tiro el anticongelante sin avisarme o que se prendiera el testigo en el tablero...cabe hacer mencion que este tipo de carros no trae ningun instrumento de medición en el panel principal a excepcion de el nivel de gasolina y aceleracion... por ende tuve que instalarle yo mismo un par de medidores... (bateria, temperatura y PRESION DE ACEITE)... En aquel tiempo cuando se me calento note que el aceite estaba blanquisco... osea que se estaba filtrando el anticongelante con el aceite... el mecanico desarmo el cabezal y menciono que se tenia que mandar a rect… Leer completa
Onix de México hace 2 años  
samuel de México hace 2 años
Parece ser mal de los pointer y de los mecànicos, mi auto presenta desde hace 2 años el mismo ruido,los mecanicos dicen que son los buzos, otros me dijeron que era la bomba de aceite, y otros màs me dijeron que estaban obstruidas las venas de aceite. Ya ya he cambiado en estos años todo esto:
Bomba de aceite,distribuidor, purgado y limpieza del sistema de enfriamiento, radiador, mangueras,anticongelante,banda de tiempo, banda de accesorios,le intalè un manoòmetro de aceite que por ciero en frio me marca hasta 60 psi, y en caliente baja hasta 8 o 5psi. El ruido lo sigue teniendo ,a veces màs a veces menos, pero le acelero y responde muy bien, yo le voy a segur dando hasta que truene, nadie me ha podido ayudar. Si hay alguien que nos ayude se l le agradece.
Aldo de México hace un año
Trata de usar aceite Castell y también a mí me ha ayudado usar un aditivo que se llama Lucas para aceite del motor lo venden en los autocine, cuando a mí me empezaron a sonar los buzos hice eso y se le quitó el ruido
PIXAS de México hace 2 años
Segun me dijo un pariente, la presion del aceite siempre va a bajar, al acelerar, pero como dices si llega asta 8 psi es muy poco por eso suenana las valvulas, intenta nuevamente cambiando tu bomba y si el ruido perisite, y los brazos que bajan las valvular de tu arbol de levas tienen otro color, ese es tu problema, ya esta DESGASTADO tu ARBOL DE LEVAS hay que cambiarlo...
Robertiko de México hace 2 años
Que onda amigos mi pointer city 2004 también hace esas cosas que describen le acabo de cambiar la bomba de aceite, la cabeza, arbol de levas y bancadas pero se sigue escuchando el ruido pero no me prende ningun testigo ni nada, mi mecanico dice que a su experiencia el ruido proviene de un perno que va en el piston que este safado y que se le hace una prueba quitando un cable de bujias cuando este encendido y si en alguno se deja de escuchar es que en ese piston esta el problema, los proximos dias les dire si se le quito o no el ruido como de golpeteo.
Ferran de México hace 2 años
Pues a mi tambien me pasa lo mismo el ruido de buzos y me dicen algunos mecanicos q es la bomba de aceite otros las charolas de los buzos y otro me dijo q cuando se desgastan los metales de bancada pierde presion de aceite.
Eduardo de México hace 2 años
HOla que tal entre a este foro por que ace rato se me calento el coche (pointer 99) la aguja de la temperatura estaba al 75% y me parpadeaba la del aceite total que me orille y al destapar el contenedor de agua ya no tenia nada le puse como 3 litros de agua y me espere a que bajara y me fui a casa leyendo los comentarios de algunos de ustedes hablan de un sonido asi como mataraca ami me lo hacia cuando se calentaba despues de andar un par de horas manejando total que fui al mecanico y me dijo que eran los busos punteria algo asi al dia siguiente compre los busos y pase a una refaccionaria a comprar un aceite y le pregunte al chavo que por que me hacia ese ruido y me dijo que eran a lo mejor las venas por donde lubrica estaban tapadas total que lo lleve con el mecanico le desmonto el catcher y el aceite tenia mucho lodo me dijo que a lo mejor era la bomba de aceite pero la bomba estaba bien total que la segun le meta gasolina al motor y lo sopleteaba lo dejo asi escurriendo como 2 dias y se le quito el ruido era muy molesto
mario de México hace 2 años
Hola buen dia mi carro es un pointer 2006 y de principio se apago y se barrio la banda de tiempo en la parte de abajo y me digiero que se había amarrado la cabeza se cambio todo banda etc y volvio hacer lo mismo nueva mente ya se repara maquina anillos metales etc jalo 3 semanas y volvi hacer lo mismo se amarro de nuevo y barrio la banda de nuevo y no se que hacer alguien me puede decir que hacer
Paola de México hace 2 años
Hola buenas noches me gustaria que me dieran un consejo he estado batallando con mi pointer 2004 , al principio le salio humo pero no cheque de donde provenia , despues al parecer quedo mal cerrado el tapon del agua y se solto y se calento. Despues de dias prendio en el tablero el aceite y se escuchaba raro con un ruido de tacataca y avanzando un poco mas se me quedo el auto, el mecanico dijo que era la bomba del agua porque le ponia y la tiraba, la cambio y el carro siguio igual y el ventilador no prendia, le cambio el bulbo o sensor del vetilador y ese mismo dia volvio a dejar de funcionar, le pongo agua y parece que no la tira pero la pierde de inmediato y hay que volver a rellenarlo y de repente ya no trae, se me calento y le quitaron las mangueras y salio mucho vapor de ellas y no estaba circulando el agua ya que una manguera de abajo al parecer estaba chupada pero despues avanze poco y se volvio a calentar,prender el agua,prender el aceite y el sonido. Si me pueden ayudar por favor ya estoy un pcoo desesperada
Onix de México hace 2 años
Ya no lo muevas se puede echar a perder el motor... hay varios puntos que revisar... el primero es revisar que el deposito de ANTICONGELANTE tenga anticongelante no agua...segundo que todo el sistema de mangueras no tenga fuga...revisar cada conexion de manguera con un paño seco...a simple vista se ve humedo o de color verde pues el anticongelante es de color verde... tambien revisar la bomba de agua donde se una con el motor... que es poco probable pero revisar minuciosamente... tercero revisa que el aceite del motor no este mesclado con agua o anticongelante... para esto debes de revisar la balloneta o varilla de medicion de aceite y checar que sea puro aceite... cuando esta mesclado notaras burbujas en el mismo aceite... o que el aceite este blanquisco. Esta es la causa de que pierdas anticongelante no por fuera si no por dentro osea en ves de que se fugue hacia el exterior se fugue hacia el motor... tambien puedes destapar el tapon del motor en frio para revisar esta consistencia... si es que ya tienes este problema necesitas llevarlo al mecanico para que revise la junta del motor con el cabezote. Por que posiblemente por las calentadas se fundio o se daño... cuentanos si ya hiciste esto
Paola de México hace 2 años
El carro se volvio a calentar y de repente solo p
Paola de México hace 2 años
El carro se volvio a calentar y de repente solo aparecieron los iconos del tablero y ya nl daba marcha fue el mecanico y dijo que estaba amarrado pero hizo unos movomientos del carro,movio las velocidades y lo desamarro ese dia llegue a mi casa el carro haciendo muchos ruidos pero llego al dia siguiente el mecanico paso por el como a las 12 y me habla como a las 4 que se le amarro casi cuando fue por el pero se me hace raro ya que habian pasado varias horas y aparte iba cerca aparcarlo y para que se amarrara debio estar caliente , dice el que por las calentadas pasadas. Sera cierto? Para mi que se lo llevo a pasear y se le amarro en el camino
Onix de México hace 2 años
Tu carro esta a punto de pasar a algo muy grave... o quisa ya este... posiblemente por las calentadas... se hayan doblado las bielas del motor. Por eso se amarra... ¿no revisaste los puntos que te mencione??... si se lo llevo a pasear o no eso es de sobra... cuenta si ya revisaste los puntos anteriores y cual fue el motivo de la calentada de esta ultima ves...asi podriamos dar solucion...
Paola de México hace 2 años
El carro usaba agua no anticongelante aunque se que es lo que necesita
Paola de México hace 2 años
Las mangueras no las puedo checar porque son de color obscuro para poder ver el agua que lo recorrer,pero ahora que esta fallando se le ha visto como una fuga pero al parecer viene de un engrane no se si sea posible, en cuanto al aceite esta en buena consistencia y nivel pero al parecer dicen podria no haber estado pasando aceite a la cabeza o algo lo obstruia y no pasaba, la bomba del agua ya se la habian cambiado. Volvere a llevar el carro a otro taller para otra valoracion porque en donde lo lleve nunca checaron fugas ni nada y me dijeron que solo con cambiar bomba y bulbo se arreglaria todo. Ese mismo mecanico me dijo que esta amarrado pero tengo entendido que para dar ese dx hay que checar el cigueñal y abrir el motor para estar seguro. Y lo que el queria hacer era voltear la maquina,rectificarlo y hacerle algo al cigueñal ustedes que opinan?
TITO de México hace 2 años
Hola , mi pointer 2004 me consume el anticongelante, se acaba el tanquesito del agua- trae nuevo el propio tanque, el tapón, el radiador, el motoventilador. No se aprecian fugas de ningun tipo, ni al exterior ni al interior. En un recorrido de 60 kilometros se vacia el tanquesito. Que opinan?
Isaac matus de México hace 6 días
Tiene que checa el aceite para ver si no esta pasado agua a motor. Si lo iso a que baja el cabezote a retifica y valvula
GABOSKY de México hace 6 meses
Tengo una falla mi pointer no pasa chispa alas vivías ya cambiamos bobina distribuidor computador fusibles y sigue sinnpasar chispa
Deportista de Estados Unidos hace 2 meses
Hola tengo un problema con mi carro es un chevy cavalier,y se me calienta y el ventilador no trabaja ya le puse nuevo,tambien le puse nuevo sensor temperatura y no prende el ventilador,lo mas curioso es que cuando lo llevo manejando la aguja de temperatura se regresa a la normalidad alguien me puede ayudar por favor que tiene mi carro gracias.
Onix de México hace 2 meses
A primera vista problema eléctrico...Primero revisa el fusible de tu carro me refiero al fusible del motoventilador...segundo revisa el arnés que va hacia el motoventilador que este correctamente puesto hay veces que lo conectan con la polaridad al revés...tercero revisa tu anticongelante... cuando se drena el radiador por hacer este tipo de reparaciones a veces queda una burbuja de aire la cual impide que el sensor tome correctamente la temperatura... has esto y comentas que sucedió o si encontraste la falla o no.
Deportista de Estados Unidos hace 2 meses
Ya cheque los fusibles incluso puse directo que prendiera el ventilador y si funciona solo en directo,me dicen que puede ser el termostato otros me dicen que la bomba de agua y no me decido a cual cambiar,aclaro la bomba de agua no hay fuga de agua.
Onix de México hace 2 meses
Siendo así entiendo que es problema el contacto del anticongelante con el sensor del radiador... esto quiere decir que efectivamente el termostato no hace su debida función... la bomba de agua también es posible algún desgaste u obstrucción alguna con algún objeto... te recomiendo que cambies la bomba ya que la nueva bomba ya viene con el termostato incluido, fin estas piezas son baratas a comparación de echar a perder tu motor por un sobrecalentamiento...ojo antes de que absorbas este gasto asegúrate de que tu sistema de enfriamiento no este obstruido cuando desmontes la bomba y revises su termostato mete presión en la manguera que va del deposito al radiador y a su vez la manguera que va del radiador al motor para que te cerciores que ninguna vena del motor este tapada por algún objeto que se haya colado al sistema de enfriamiento... ya que aveces cuando pasas a la gasolinera y pides anticongelante...el empleado lo hace mal ya que ocasionalmente se les va el sello de aluminio del recipiente al deposito de anticongelante (revisalo), también en reparaciones anteriores los mecánicos dejar restos de silicona para sellar las piezas... es importante que revises también las mangueras por dentro con tu dedo ya que tienden a deshacerse poco a poco esto y esto enturbia el anticongelante (lo oscurece) es un trabajo de paciencia... pero lo recomiendo para que en el futuro no te pase algo peor. Cuenta si encontraste la falla
Deportista de Estados Unidos hace 2 meses
Hola ya hice el procedimiento cambie el termostato y la bomba de agua y sigue igual incluso salio peor porque la aguja de temperatura sube mas y el ventilador sigue sin prender y la verdad yano se que hacer cheque todas las mangueras y no encuentro fuga. Podrias ayudarme en decirme que paso hago ahora?
Deportista de Estados Unidos hace 2 meses
Hola ya hice el procedimiento cambie el termostato y la bomba de agua y sigue igual incluso salio peor porque la aguja de temperatura sube mas y el ventilador sigue sin prender y la verdad yano se que hacer cheque todas las mangueras y no encuentro la fuga alguien me puede ayudar en decirme que paso y que debo de hacer ahora? Gracias
Onix de México hace 2 meses
Si ya no tienes fugas y tu sistema de enfriamiento esta sin alguna obstrucción, y comentas que esta correctamente puesto el ventilador ya revisado con el arnés...y la bomba y termostato son nuevos y correctamente instalados... solo tienes tres opciones hay de otra...1. - revisa que tu sensor haya sido el correcto que sea funcional y marque el paso de corriente a la temperatura indicada...2. - Revisa que no haya burbujas dentro del sistema de enfriamiento, haciendo el debido purgado del anticongelante...3. - Revisa el fusible del ventilador y el relevador que sirve para abrir y cerrar el paso de corriente eléctrica...
Te mando un video tutorial…
Ve los 4 videos te serviran
Deportista de Estados Unidos hace 2 meses
Ya hice todos los procedimientos y la aguja de temperatura ya no sube mucho solo pasa un poco de la mitad,pero el ventilador sigue sin prender. Sospecho que es la computadora que me recomiendas comprar una y ponerla,crees que no desactive todo el sistema de mi carro al poner otro?

El motor cascabelea mucho y se sobrecalienta SolucionadoSolucionado

Volkswagen Pointer 2000 station wagon 1.8 245000 kms
Hola amigos, pues resulta que mi querido pointer a partir de un recorrido en subida, botó el anticongelante por sobrecalentamiento, el mecánico me dijo que tenía el tiempo adelantado, lo atrasó un poco, pero de igual forma se seguía calentando, y sin potencia, le cambió bomba de agua, radiador junto con su sensor, una manguera, tapón del depósito y seguía igual, en mi desesperación por este problema, le moví el tiempo "a puro oido" y funcionó bien un tiempo, pero otra vez lo mismo, según el manual que tengo, lo ponen a 9 grados y es espantoso el cascabeleo, (este modelo todavía salió sin sensor de posición de cigüeñal) si alguien supiera y pudiera ayudarme, gracias!
fortachón de México hace 4 años  
gabo de México hace 4 años
El cascabeleo de sebe a que el aceite que tiene el motor no es el adecuado,ponle castrol del 40 y que te calibren las bujias que sean de platino,tambien revisa el sistema de enfriado ya que suele suceder que los paneles de el radiador esten tapados y el aire de el ventialdor es insuficiente lavalo con con hidrolavadora de los dos lados
Mejor respuesta (según fortachón)
fortachón de México hace 3 años
Les comento cómo se solucionó este problema:Resulta que tenía saltado dos dientes la banda de distribución, por eso no quedaba bien a tiempo. Y el radiador lo tuve que llevar a desarmar y sondear. ¡Gracias Gabo!, por tu sugerencia.
Lalo de México hace 9 meses
Buenas tardes tengo un pointer 2005 quite la toma de agua por qué rompió el sensor de tablero ,pero ahora que lo volvía colocar tiene fuga toma de agua ya limpie la toma y quite la suciedad pegada pero al colocarlo echarle anticongelante se sale el anticongelante lleva un empaque negro volví a colocar el mismo pero suele sigue saliendo alguien que me ayude si lleva alguna junta o o solo el empaque negro o ahí que cambiar toda la toma de agua
Salvador Valdivia de México hace 16 días
Buenas tardes una pregunta ayer deje prendido mi pointer 2000 un rato y por desgracia no prendio el ventilador se calento demasiado me tiro el agua empezó a sonar como sonaja un sonido como tacatacatacatacataca y se apago y lo quise prender a empujones y no lo hice prender, ustedes me podran decir que le paso si se me desvielo que. Le paso a mi carrito?

Se calienta mucho al encender el clima SolucionadoSolucionado

Volkswagen Pointer 2007 trenline 95000 kms
Ya cambie bomba de agua, radiador, motoventilador completo,deposito de anticongelante y tapon nuevo, bujias, cables de bujias, bobina, sensor de temperatura,sensor del ventilador,termostato nuevo,cambie aceite del motor,limpie valvula iac,puse anticonjelante no me pasa aceite al radiador, ni agua al aceite del motor,ya linpie el condensador del clima por fuera,cambie banda de distrivucion, ya escanie,esta bien a tiempo, se calienta mucho el motor al encender el clima, ya estoy desesperado ahora que le hago, gracias x contestarme le agracecere mucho.
TILO RICARDO DEL VALLE de México hace 2 años  
Mejor respuesta (según TILO RICARDO DEL VALLE)
TILO RICARDO DEL VALLE de México hace 2 años
Mi problema estaba en el sensor de temperatura que era comercial aunque nuevo, solo compre el original de agencia y el problema se soluciono, des pues de cambiar todo el sistema de enfriamiento di yo con el mal ya que los mecanicos solo son cambia piezas si saben cobrar bien solamente.
pacoz de México hace 2 años
Disculpa que marca es el sensor y cuento te costo saludos

El ventilador entra hasta 110-120 °c SolucionadoSolucionado

Volkswagen Pointer 2001 4 puertas furgoneta 1.8  200 kms
Tengo un pointer furgoneta 2001 tiene la falla de que el ventilador entra hasta los 110-120°c se le cambió bomba de agua hace como 4 meses se checo con otro radiador se le cambiaron las mangueras que se veían mal hasta el tablero se le cambió y no deja de hacer lo mismo todos los sensores son nuevos incluso el bulbo la cabeza se mando a rectificar ya no se que mas pueda ser estoy desesperado si me pudieran ayudar
joshua de México hace 2 años  
wolfburg de México hace 2 años
Checa la resistencia del moto ventilador es una redonda y cambiala o ponlo directo pra evitar calentones
Isrsel de México hace 2 años
Checa el bulbo del radiador o el relevador o la resistencia del moto ventilador y de paso el termostato cabe mencionar q es muy importante q lo traiga porque al ser de doble paso al abrir a tempratura de 90 cierra una compuerta y hasi fluye rapidamente el agua al radiador de lo contrario si no lo trae el refriguerante se queda dando vueltas en el motor pasando muy poco refriguerante al radiador
Chego de México hace 2 años
Tengo el problema que no marca la gasolina ya cheque el flotador y se ve que funciona bien me dijeron que puede ser mi tablero si alguien me puede oriental si la falla si puede estar en el tablero gracias
ebarron de México hace 2 años
Tu termostato amigo... checalo. Esta abriendo muy tarde.
albar de México hace un año
No comentas si tiene aire acondicionado porque si lo tiene entra el ventilador de la segunda velocidad
Mejor respuesta (según joshua )
joshua de México hace 10 meses
Muchas gracias amigos ya solucione el problema era falta de tierra física en el sensor de temperatura por lo que mandaba una mala señal a la computadora

Falla compresor y aceleramiento SolucionadoSolucionado

Volkswagen Pointer 2002 4 puertas electrico 19000 kms
Bueno primero que nada espero me puedan ayudar, tengo un pointer 2002, hace unos meses cambie la bomba del agua y el termostato y la banda del tiempo, pero dese ese tiempo el carro ha estado con un aceleramiento no comun solo en los cambios de primera y segunda, se acelera arriba de las 3500 revoluciones, por un buen rato, cuando meto segunda o lo dejo en neutral el carro esta normal. Solo cuando esta en marcha es cuando hace eso del aceleramiento, que podra ser? tambien tengo otro problema, el compresor del aire acondicionado no deja de funcionar haci este apagado los controles de adentro el compresor esta funcionando, como pudo desconectarlo?
cesar galindo de México hace 3 años  
Mejor respuesta (según cesar galindo)
galloso21 de México hace 2 años
Ya checaste la válvula iac puedes lavarla o remlasarla

Se prende testigo del aceite al calentarse el motor

Volkswagen Pointer 2004 city 190000 kms
Hola que tal les comento sobre esta falla que tuve, resulta que hace 15 días prendía intermitente mente el testigo del aceite solo hasta que se calentaba el motor pero solo cuando dejaba de acelerar prendía el testigo, el cual revise el nivel de aceite y le puse poco por si es que le faltara, no se apago el testigo, después cambie el bulbo de aceite pero solo se quito por un día y regreso la falla, se cambio el filtro de aceite y de marca y siguió igual, se reviso que si tuviera la presión adecuada y que si subiera el aceite al árbol de levas y si estaba bien la bomba de aceite, después de rev… Leer completa
el isrra de México hace 2 años  
norma de México hace 2 años
Hola tengo un gol, esta tirando anticongelante, lo revisaron y le cambiaron la bomba, funciono dos días, y el día de hoy volvió a tirar anticongelante y de plano ya no arranco, que creen que pueda tener? gracias por su ayuda¡
vale de México hace 2 años
A mi jetta le prende el foco del aceite le cambiamos la bomba del aceite y el cedazo y el ruido que hacia se le quito ( botadores ) pero el foco sigue prendiendo ya revisamos el nivel de aceite y esta bien, alguien que me pueda ayudar, como dato el carro encendido en neutral no prende el foco solamente cuando acelero.
manu de México hace 2 años
Disculpa y donde se encuentra el termostato de pointer?? Igual me pasa lo mismo en mi pointer
CUERUDO de México hace 2 años
El termostato del pointer loTiene en la bomba donde se conecta el radiador parte de ABAJO.
Sanchez de México hace un año
Yo tengo el mismo problema en mi pointer 98 ya le cambie la bomba y el bulbo y aceite y se sigue prendiendo el testigo del aceite
Catana de México hace un año
Se puede conseguir la pieza que va adentro del motor es un engrane que el mecánico me perdió que hace girar la bomba de aceite de un pointer 2004


Volkswagen Pointer 2003 4 puertas 100000 kms
Hola que tal buenas tardes, estoy desesperado ya no encuentro como reparar mi carro , tengo un pointer 2003 el cual un dia lluvioso la bomba del agua de estropeo se revento, como el dia estaba frio y con lluvia el carro andaba bien , fue en la tarde cuando lo volvi a usar y se me prendio el foco del aceite (este carro no tiene medidor de temperatura) lo apaguee rapido compre refrigerante y vi que se salia por la parte de abajo, bueno el chiste es que le compre la bomba y funciono pero a lass 4 horas se quedo sin agua , fui al mecanico y me demostro que no habia fuga , con el tiempo me salia va… Leer completa
maupad de México hace 3 años  
cracks de México hace 3 años
Hola lo mismo me paso, es simple revisa el tapón del deposito del refrigerante y ya sea ke le falte una liga (empaque) ó se movió de su lugar la liga. La liga a de costar $5MX y el tapón de los mas económicos desde $35MX NOTA: no dejes ke se te caliente ni lo dejes sin agua. ¡comenta como te fue!
BENJAS de México hace 3 años
Hola que tal, porque no revisas la bayoneta del motor y checas que el agua no se este pasando al aceite, es común que con los calentones se tuerzan las cabezas y se pase el agua hacia el motor, la coloración del aceite se torna de un color café con leche e incluso tiene un olor muy raro, ojala que no sea eso porque si no va a ser una reparación algo cara. ¡suerte!
maupad de México hace 3 años
Hola ya cheque el orring y esta bien muchas gracias Cracks, disculpa benjas el aceite no se ve achocolatado pero me gustara checar mas a fondo como puedoo checar o reparar eso gracias
marbe de México hace 3 años
Hola, yo tengo un pointer 2003 std y al igual revisaba el agua porque no sabia que era ya le habian cambiado la bomba y era raro que seguido tuviera que revisar el agua y en avenida vi que salia humo como si se hubiera calentado y pare, y todo el anti-cogenlante lo tenia en los pies, en eso no me fijaba solo veia que estaba mojado mas no inundado jajjaja pues bien le puse nuevamente agua y busque taller y lo que le hicieron fue taponear el ducto o manguera del aire que era lo que hacia que se regresara el agua y que el radiador del aire que despues lo comprara para quitar ese tapon, no entendi mucho pero asi me dijeron y la verdad no he vuelto a tener prolema con calentamiento que tire o regrese el agua... espero te sirva, que te revisen esa manguera que va al aire ah!! lo unico es que ya no puede utilizar el agua del limpiaparabrisas, esta el deposito pero ya no deja que salga el agua es lo que note saludos
daniel de México hace 3 años
Tienes que quitar la cabeza y mandarla cepillar y cambiar la junta de la cabeza y listo suerte
jarocho de México hace 2 años
Hola banda miren tengo un pointer 2002 despues de un viaje de 3 horas se rompio la manguera d agua del rradiador enseguida encendio la luz del aceite ya rremplace la mangura la luz se apaga pero despues de 20 minutos trabajando enciende la luz de aceite de nuevo iy empieza atironearse. Espero me puedan ayudar
Pid Absrael de México hace 2 años
Hola tengo un pointer 2007 e notado que el ventilador enciende con frecuencia mi pregunta es eso es normal o con que frecuencia debe serlo
asarl de México hace 2 años
Yo tengo un pointer 2001, igual se rompio la manguera del anticongelante, sufrio un pequeno calenton, un dia despues se encendio la luz del aceite, lecambie el bulbo del aceite y listo, pero despues de u. A media hora uso se encendio otra vez, le cambie la bomba de aceite, y otra vez lo mismo
Aclaro que solo se enciende en neutral, acelerando se apaga, ayuda por favor!!

Se eleva la temperatura hasta 120 grados aunque ya se cambio el bulbo

Volkswagen Pointer 2000 4 puertas  198000 kms
Hace 2 días empese a notar que mi temperatura empezó a subir de la nada ,inmediatamente me pare y cheque si el agua del deposito burbujeaba ,si la bomba de agua hacia algún ruido, si alguna de las mangueras se encontraba fría pero nada al parecer trabaja todo bien el ventilador se prende cada 4 o 5 minutos no burbujea el agua del depósito no tira anticongelante incluso no trae termostato la temperatura se eleva hasta 130 grados y en cuestión de unos segundos baja a 90 ya cambie bulbo de temperatura no se que podrá ser mi radiador es nuevo el ventilador trabaja bien estoy desesperado
mike de México hace 3 años  
ebarron de México hace 3 años
Sacale el AGUA y ponle anticongelante... notaras la diferencia
mike de México hace 3 años
Trae anticingelant no tiene fugas y no lo consume cambie el bulbo de temperatura y qdo peor le volví a poner el que tenia y ya no me lo a hecho el bulbo de temperatura se pide con un gradado especial?
ebarron de México hace 3 años
Correcto. Tienes que pedir el que lleva tu auto, si mal no recuerdo es el de 127 grados.
mike de México hace 3 años
Es el de 120 así vi es uno color negro vdd el q va arriba xq el de abajo es el q manda la señal a la computadora y ya le quite el que había comprado y le puse el que le quite y solo fallo ese día q se lo puse y ahorita no me a fallado pero se lo cambiare esperó sea eso gracias o q otra cosa podrá ser
IPXSPX de México hace 3 años
1. - Definitivamente PONLE el termostato!... ya que éste no es supresor del flujo, sino redireccionador de flujo... el agua puede estar circulando del radiador a la bomba y de la bomba al radiador, mas nunca entra al motor. 2. - Este coche esta diseñado para trabajar a temperaturas NORMALES arriba de 100°C, por lo que pónerle agua lejos de ayudarte te va a perjudicar, ya que al evaporarse eleva la presión en la linea de refrigeración y puede "volar" las mangueras plásticas, juntas y/o tapones (el punto es que siempre va a intentar buscar liberar la presión, y en ese punto algo te va a tronar).

Sensor de temperatura del anticongelante SolucionadoSolucionado

Volkswagen Pointer 2005  159000 kms
Disculpa. Ya cambie termostato, la bomba de agua, el interruptor térmico, y por ultimo el sensor de temperatura. Al leer el instructivo me dice que tengo que borrar el codigo de falla, es necesario o solo se cambia ya que se sigue calentando como si no abriera el termostato. Al probar el termostato con agua caliente abre perfectamrnte
ruben de México hace 10 meses  
Mejor respuesta (según ruben)
gabriel de México hace 10 meses
Asi es amigo tienes que borrar el codigo de fallo ya que la computadora lo deja guardado en su memoria y en algunos casos el fallo sigue hasta que los borras, ahora tambien algunos modelos cuando colocas el nuevo solito lo regulariza, pero si el instructivo lo dice hay que seguir esas instrucciones, cualquier escaner lo puede hacer, saludos y suerte
ruben de México hace 9 meses
Gracias un poco tarde es mi respuesta. Lo que pasa es que tuve algunos imprevistos, bueno te comento que despues de tanto cambio resulto que una de las mangueras estaba tapada y es la que va del radiador al deposito y con solo un alambre se soluciono todo. Bueno espero que alguien tenga algun manual del pointer ya que es un carro que me gusta mucho, y que por lo general no me da ningún problema es muy importante tener un buen manual
ruben de México hace 9 meses
Gracias, ya solucione mi problema. Spero seguir en contacto

Elevación de la temperatura en subidas prolongadas SolucionadoSolucionado

Volkswagen Pointer 2001 2 PUERTAS GTI 277000 kms
Alguien me puede ayudar, ya que no encuentro la falla de mi pointer GTI 2001, ya le cambie la bomba del agua, el bulbo que va en el radioador, el bulbo de la temperatura que va en el monobloc, ahora me dice el mecanico que es el radiador, pero yo no le creo, asi mismo le quite el termostato para checar si era el termostato o no, el radiador no creo que sea porque si circula bien el agua, y mas porque al momento que la temperatura sube a los 110 grados el carro deberia de estar super caliente y se sintiera burro, y no es asi se siente normal, cuando le sube la temperatura a 110 o 115 grados lo… Leer completa
Oscar Martinez de México hace 3 años  
el miau de Argentina hace 3 años
Esta bien purgado? es raro cuando pierde asi o lebanta temp es porque tiene aire el radiador... purgalo y proba
Mejor respuesta (según Oscar Martinez)
Oscar Martinez de México hace 3 años
Ya Resolví el problema, sucede que no tenia termostato, solamente lo ,cambié y también le cambié el bulbo de la temperatura del radiador y listo.
Aberno de México hace 2 años
Oye tengo ese problema yo. Le pusiste el termostato y cambiaste cual bulbo aver si te puedes comunicar conmigo ya sea por whassp 5523013591 o por correo por fa xq ya me aburri con mi pointer gti me. Gusta mucho pero no encuentro la. Solucion al calentamiento ya hice muchas cosas pero no queda

Detalles del pointer

Volkswagen Pointer 2001 gti
Que tal señores yo les puedo decir que los unicos pointers que salieron mal fueron los mas equipados lo digo por experiencia en el caso del de un servidor les puedo mencionar algunas de las cosas mas reelevantes que me sucedieron como por ejemplo: se acabo antes de tiempo el clutch (pero eso pudo ser por neglijencia del dueño anterior) el compresor del aire acondicionado (ese como quiera no mas se desconecta y ya) la cremallera, la bomba de agua, la bomba de la direccion hidrauldica, el sensor del aire y el vdo (que regula las revoluciones). , de las personas que conozco y traen el base no tie… Leer completa
usuario anónimo de Mexico hace 10 años
TORTUGON CRUZ de México hace 3 años
Se prende y aoga el comoresor del xlina que. Puedo hacer para corrgir la falla
Jose de México hace 3 años
Cual seria el consumo de combustible normal para un pointer 1999?
hussein de México hace 3 años
Hola tengo una pointer wagon 2000 y mi problema que tengo es que con un rato de estar avanzando se calienta el carro y cuando me detengo y lo revizo veo que el agua del deposito se evapora lo lleno y despues avanzo otro rato y se Vuelve a calentar que puedo hace
Ignacio de México hace un año
Deberias de Cambiarle el termostato, a lo mejor no esta Dilatando, y eso provoca que no se Accione el Ventilador. Yo tenia un problema similar y desarme todo el Radiador, la linea de enfriamiento, el deposito, y al final de Cuenta solo le cambie el Termostato y no tuve ningun problema. Saludos!

Calentamiento solo en alta velocidad Pointer 2000 wagon

Volkswagen Pointer 2000 POINTER WAGON 125450 kms
Hola alguien me puede ayudar ya tengo 4 dias en el taller revisando mi carro por calentamiento pero aun no queda, se calento al ir circulandao a alta velocidad me orille para revisarlo y por el deposito se derramaba el anticongelante, ya en el taller revisaron el termostato,bomba de agua, poleas ,bandas, bulbos de temperatura y ventiladores etc

Pero aun no me dicen nada, de hecho el dia de ayer lo encendi y se quedo pegado el ventilador del radiador hasta por 40 min despues de haberlo apagado. Lo tuve que desconectar y hasta ahora no lo he encendido

pako molinero de México hace 5 años  
arturo martinez de México hace 5 años
Yo tuve el mismo problema checa el relevador del color naraja debajo del tablero, pero compra el original ,si no no te va atrabajar como debe de ser anada al rededorbde 250 pesos
pako molinero de México hace 5 años
Ok arturo martinez lo reviso pero que debo de ver en el rele? si es el original o esta dañado??
Charly de México hace 5 años
Como bien comenta Arturo Mtz. Cambia el relé del ventilador, ojo no es el naranja, no es ninguno de los que están sobre el compartimiento de fusibles, está colgado a un costado de éste, del lado izquierdo, a mí me sucedió lo mismo o no funcionaba el ventilador o se quedaba encendido. Espero mi comentario te ayude en algo, Saludos.


Volkswagen Pointer 2000 2 puertas, motor 1.8 100000 kms
Tengo un problema de sobrecalentamiento con mi pointer, y me ha pasado como 5 veces, al recorrer 20 km aproximadamente se me sobrecalienta el pointer.
Ya cambié la bomba del agua, el deposito, el bulbo y el problema continua. El agua en el deposito se reduce y no detecto fugas de agua por las mangueras o por el radiador, el radiador lo "sopletearon", purgué el sistema y no trae termostato.

El ventilador, entra a los 95° aproximadamente y en una ocasion el ventilador no entraba a tiempo, el mecanico me comento que el pointer tiene el tiempo muy alto.

Alguien me puede ayudar con mi problema??, que me recomiendan hacer??. Estoy pensando en comprar el ventilador y el radiador
alexlp de México hace 3 años  
Kz007 de México hace 3 años
Que año... Yo tengo el mismo problema y lo solucionaba con un bulbo en baja de 79 a 85... Busca alguna refaccionaria de parte originales vw
Pd. Mi pointer es 99
edgar de México hace 3 años
Yo tenia el mismo problema y te sorprenderás de la solución... Resulta q me tope con un mecánico honesto y me dijo q solo era el tapon del recuperador donde va el anticongelante, yo la verdad lo hice algo incrédulo pero solo faltaba hacer eso y mi sorpresa fue q se solucionó el problema, compra el original solo cuesta alrededor de 70 pesos
looiiss de México hace 3 años
Hola edgar es logica tu respuesta hay que revisar posible fuga en tapa con jabon liquido msj 5527630314

Gasta mucha gas

Volkswagen Pointer 2006 2 puertas 90000 kms
Lo lleve con mecánico para que le cambiara banda de tiempo y bomba del agua y como que se tironea, ya según lo pusieron en tiempo, comp iba a viajar le cbiaron iac, sensor de oxígeno, map o maf , hice afinación mayor y pues si estira muy bien , sólo que en los altos o semáforos se escucha una ligera aceleración por segundos de que run run run y aparte me gasta lo doble de gas , al principio olía como a gas del mofle.
Rigo de México hace 2 años  
Jucastor de México hace 2 años
Esta respuesta es para todos aquellos que tienen un pointer y tiene altos consumos de gasolina, tironeos, tiembla etc. lo que se tiene que revisar primero que el sistema de admision es decir las mangueras de aire en la entrada al motor y derivaciones se encuentren en buenas condiciones la temperatura, polvo, calor y humedad las dañan mucho sobre todo a la principal que viene del filtro de aire,. Una vez revisado todo esto verifica que el sistema de enfriamiento (radiador y demás) se encuentre en condiciones es muy comun el deterioro en mangueras, termostato, radiador y depósito. Terminado todo esto si ya puedes enfocarte en el sensor TPS si se tironea, valvula iac si se queda acelerado y sensor de oxigeno. Limpia y cambia x lo menos cada 30 m KMS. la tapa del distribuidor. Verificando todos estos puntos en el orden que fueron escritos tu pointer funcionara de la forma más eficiente. Saludos y suerte.
chava H. de México hace 2 años
Lo que propisia el alto consumo de gasolina es la valvula reguladora de gasolina por eso el holr a gas en el escape reemplazala y solucionado tu problema.

El anticongelante se tira SolucionadoSolucionado

Volkswagen Pointer 2002  200000 kms
Hola tengo un pointer 2002 que tira anticongelante del deposito, tiene bomba de agua nueva, deposito y tapa nuevo, se le quito termostato, el motoventilador funciona, se cambio el bulbo q activa el motoventilador
Lo raro es q en ocasiones puede recorrer 50 km sin problemas y otras veces en menos de 5 km derrama el anticongelante, es muy impredecible, creo q el problema es electrico , alguien me puede ayudar
HEIV de México hace 3 años  
Rafa de México hace 3 años
Sensor de la temperatura. Para mejor diagnostico estamos en naucalpan 5545423444
Mejor respuesta (según HEIV)
HEIV de México hace 3 años
Gracias pero fue el motoventilador a pesar de q si funcionaba a veces entraba y aveces no por eso era muy impredecible

Falla al calentarse

Volkswagen Pointer 2001 station wwagon 175000 kms
Hola amigos foristas, solo para comentarles que despues de cambiar bujias, cables de bujias, escobilla o rotor, tapa de distribuidor, bomba de gasolina, lavar inyectores y limpiar valvula Iac mi pointer guayin seguia teniendo un fallo al calentarse, le cambie el bulbo de temperatura por uno de Caribe que encendia el ventilador a 75 grados y fallaba menos pero aun lo hacia. Aqui en el foro lei que checara si tenia termostato en la bomba de agua, hoy lo lleve al mecanico y hoo sorpresa, no tenia, se lo pusieron y le cambie el bulbo de temperatura normal de 90 grados y pues ya quedo. Como nueva.… Leer completa
Chiplotle Encapuchado de México hace 3 años  
IPXSPX de México hace 3 años
Excelente aportación... hace días leí algo similar y sugerí ponerle el termostato, ya que a mi parecer, creo que el termostato es de redirección y no de restricción de flujo de agua!... Que bueno que ya quedó, saludos!
beto de México hace 3 años
DE hecho actualmente todo coche de cualquier marca si le quitan el termostato les provoca fallas similares por eso hay que ponérselo y ojo hay que instalar de la misma capacidad de temperatura de antemano gracias a todos que como tu que al solucionar su problema lo comparten salu2.
Viko rivas de México hace 3 años
De cuantos grados debe ser el termostato y el bulbo como saber si me. Dieron el correcto en la reaccionaria
Pepito de México hace 3 años
Gracias por tu aporte hermano me atrevo a decir que el 90% de los "pointeros " hemos tenido está falla y siempre creemos o nos hacen creer que es falla eléctrica o de combustible, de nuevo gracias
tiburon de México hace un año
Hola tengo un pointer 2001 tengo el problema que esta fallando cuando ya llevo un tiempo usandolo y me detengo en algun lugar ya no quiere arrancar da trabajo y si prende y dejo de acelerar se apaga da trabajo que vuelva a rrancar sea de dia o de noche, si no de repente se acelera tengo que a pagar y volver a encender. Hasta que arranque normal... alguien puede orientarme de que podria ser?
sunshine de México hace 6 días
LLeva una botella de agua y cuando tengas el problema vierte el agua sobre la bobina (es la que lleva el cable corto al centro de la tapa del distribuidor) si se corrige la falla cambia la bobina pero por una Bosch o Duralast de preferencia una original. Normalmente el problema se presenta después de apagar el carro, es decir cuando el motor ya está caliente y cuando quieres arrancarlo de nuevo se tironea y se apaga, espero que te ahorres los 4000 pesos que me sacaron los mecánicos que no le encontraron el problema ni con el scanner. La bobina cuesta como 280 pesos y solo tienes que quitar 2 tuercas.

Fallas comunes

Volkswagen Pointer 2004 2p 1.8L 2004 city 94000 kms
El problema de este auto es que las piezas que trae son de muy mala calidad y desechables asi que sus problemas son comunes, estos son los problemas que tuve con mi pointer:
Se revento manguera de refrigerante, fuga de aceite por una pieza que se tuvo que cambiar, fuga de liquido direccion hidraulica el cual se va a los pies del conductor, falla de sensores, cambio de valvula IAC, varillas de direccion, juntas homocineticas, bomba de agua.
Es un buen auto pero aunque le des sus mantenimientos las piezas van a tronar en poco tiempo comparado con otros autos, sin embargo las piezas son muy baratas. Dure con el 5 años y no me arrepiento me la pase bien en el.
Jose de México hace 5 años  
looiiss de México hace 3 años
Holatodod los autos necesitan mantenimiento preventivo o correctivo algunas pzs es mejor comprarlas en agencia otras no afecta invierte en manuales automotrices o videos y algunos cursos para hacerte un experto mecanico te servira mucho feliz dia
Jose de México hace 3 años
Así es, pero en el caso de este auto en particular (que yo viví la experiencia) las piezas truenan por su mala calidad incluso si son de agencia, a diferencia de otro tipo de autos que sus piezas duran decenas de kilómetros sin problema, a veces piezas que nunca tienen que cambiarse, pero ahí es donde radica la diferencia en precios, en la calidad de los componentes que forman el auto completo.


Volkswagen Pointer 2003 STD 5 PTAS
Sin trauma alguno compre un Ponter std. Muy sedita y todo super bien pero solo basto que le cambiara las balatas delanteras y todo le empezo a sonar y fallar, cambie radiador, despues segui con manguera, bomba de agua, bulbo del ventilador y comenzo a inundarse de anticongelante que dijo el mecanico que el radiador del AC no servia cancelaron los ductos y por si fuera poco la velocidad 3ra la bota que son los bujes y que es un problema de siempre de los pointer y todo mundo quiere bajar la caja que sale de 5mil a 7 mil todo le suena ! todo lo de plastico de mala calidad al igual que el golf qu… Leer completa
usuario anónimo de México hace 5 años
MOys de México hace 5 años
Tuviste mala suerte
pointerceptor de México hace 5 años
Mi pointer 200 lo compre usadito y ya sabia que le hiban ha salir achaques con el tiempo , pero ahorita esta en buenas condiciones todo los carros usados les pasa eso. ( por algo los venden ) algunos se nos da la mecanica a otros no , trato de reparar las cosas que no son tan dificiles y lo mas pesado lo llevo con 1 mecanico de confianza ( otra cosa dificil de encontrar ) por que si lo llevo ala agencia todo me sale al triple , te recomiendo si gustas o puedes , reparar tu mismo las cositas faciles y si es verdad arreglas una cosa y sale otra , ten paciensia y trata de tomarle gusto ha tu auto veras que cuando le arregles 1 falla te sentiras muy agusto y sabars mas de tu auto yo tengo 12 años con mi pointer 2000 y he viajado hasta housto texas - monterrey - catemaco veracruz - pachuca hidalgo hasta la sierra de tepehuacan de gro. Y de regreso ha monterrey varias veces y es muy economico y funciona muy bien. Lo del pastico del tablero si es chafo alli si tienes mucha razon como te digo no hay carro usado que no le tengas que meter mano
gabrielmx de México hace 2 años
El carro es de mala calidad, solo funciona en el tiempo de garantia, despues son puros problemas, tambien tengo uno y la verdad ya se esta poniendo muy enfermo y eso que es 2008

Percibo que vibra mucho el motor revolucionado.

Volkswagen Pointer 2004 city 199000 kms
Hola que tal,
¿mi pregunta es, que tanto es normal la vibración del motor?
A una velocidad de camino de 80 km× hora percibo que vinra mucho en comparación co otros carros. Me doy cuenta de esto porque el espejo retrovisor a la par del motor, está bién pegado así que no es retrovisor flojo. La polea de la bomba del agua observo que gira un poco como si estuviera chueca. De antemano gracias por los comentarios y el espacio.
El richar. de México hace 3 años  
IPXSPX de México hace 3 años
Las vibraciones excesivas vienen de desbalanceo. La pregunta es ¿en donde esta el desbalanceo?. Le han cambiado el clutch ultimamente? la vibración solo la percibes en el espejo? o también en el volante?. . .
Pienso que tal vez, te cambiaron el clutch y/o el volante del motor y tal vez por ahí venga la vibración, también deberías balancear tus llantas, para descartar que sea falta de balanceo (o tal vez inclusive hasta un chipote en las llantas te generen la vibración).
beto de México hace 3 años
A mi me paso que se me daño la marcha y como mi carro es con aire acondicionado tienen que quitar el tacon de soporte del motor para poder sacar la marcha total que lo colocaron mal después de poner la marcha y me generaba vibracion lo tuve que cambiar pues se deformo y asunto resuelto. Salu2.

Vw gol se apaga al darle marcha

Volkswagen Pointer 1999 5puertas 1.6  456890 kms
Buenas noches, resulta que cambie la bomba de agua de mi auto, por error se saltó el tiempo la banda, luego deje a punto todas las poleas (incluido distribuidor) y al encenderlo regule solo con el distribuidor para que se "mantenga en tiempo" debido a que no tengo la lámpara. El problema es que al encenderlo se mantiene "estable" pero al meter cambio y arrancar a medida que voy soltando el embrague, se me jalones como si se estuviera ahogando y se me apaga. No entiendo que puede ser, estuve leyendo que puede ser el tiempo, pero no sé si sea lo cierto porque todas las poleas si quedaron en punt… Leer completa
Leonardo Cabrera de Ecuador hace 2 años  
Tinajero de México hace 2 años
Puede ser la tapa del distribuidor o la escobilla
angelopolis de México hace un año
Si de casualidad le cambiaste el clutch ????? fue que no le pusieron bien la tierra, a mi me paso lo mismo y resulta que los mecanicos decian que era el distribuidor y no era eso mi electrico le puso la tierra del chasis a la caja y listo encendio de volada lo puso a tiempo y ahora jala de maravilla
angelopolis de México hace un año
Costo de reparacion un cable y dos terminales para la tierra $12 pesos, pero si le haces caso al mecanico te hara comprar el distribuidor la escobilla y la tapa ademas de los cables y demas cosas que se les ocurra de aqui a que le atinan suerte amigos

Regresa el refrigerante al deposito de recuperacion

Volkswagen Pointer 2007 4 puertas 114000 kms
Al acelerar el carro el nivel del deposito de refrigerante se empieza a subir hasta que se derrama por el purgador, al desacelerar empiza a bajar hasta quedarse en el minimo y en ocasiones mas abajo, lo mismo que cuando prende el motoventilador y esta derramandose tambien empieza a bajar totalmante, ya le cambie termostato, tapa del deposito , el deposito , se reviso la bomba de agua, se reviso las bujias y no presentan humedad ni el motor falla ningun cilindro, solo es el derrame del refrigerante por el deposito, ojala me puedan ayudar, gracias
Juan Lopez de México hace 2 años  
frank de México hace 2 años
Dises q se le cambio e termostato? Lo remplasast o se lo quitast?si se lo reemplasast por otro mejor q se lo quiten no sirve de nada tengo un pointer 2001 q gracias a ese termostato se me calento y tuve q rectifcar cabeza asi q opte por quitarlo y asunto arreglado es como una maldita apendise esa chingadera de termostato.
Juan Lopez de México hace 2 años
No le encontraron la falla sigue derramando el liquido y sigo rellenando diario.
Jesus alvarez de México hace 2 años
Verifica ke las mangueras del recuperador no esten tapadas ya ke al no tener paso el agua empieza a hervir y busca la salida x el rekuperador y es por eso que se tira el agua me pasaba igual espero y te sirva
Arturo de México hace un año
Me pasa lo mismo, enciendo el coche y al calenarse comienza a tirar el agua por el deposito hasta que entra el ventilador ; pero vuelve a calenarse tiramdo mas agua... Siento que tarda en entra el ventilador

La banda rechina

Volkswagen Pointer 2001  333456 kms
Lleve mi carro a su afinación y al termino la banda se rompió el mecánico me dijo que debía cambiar las poleas y la bomba de agua, pero ahora rechina la banda y se me trono la manguera del agua??
oscar vallejo de México hace 3 años  
Rafa de México hace 3 años
Es cierto, si rechina son las poleas tensoras o alguna otra polea , aunque no por ser nuevos descartes su revision muchas veces la marca tiene que ver con la calidad y si es mala puede ser que siga rechinando. Y las mangueras puede ser que si la bomba no trabajaba bien algun lado del motor calentaba mas las mangueras que el otro al no tener buena circulacion. Para mejor diagnostico estamos en naucalpan 5545423444
René de México hace 3 años
Te cuento... durante mucho tiempo traje el problema de rechinido de la banda de motor, y me dijeron que era por que no es original, compre la original y fue peor, al encender el clima llegaba hasta el punto de calentarse la banda y salir humo, me dijeron que era el balero del compresor del clima... fui con un climero y honradamente me dijo que un error en los vw pointer´s y demas es que ponen mal la banda, te aconsejo que busques como va puesta y la revises para descartar...…


Volkswagen Pointer 2000 station wagon 1.8 79000 kms
Tengo un pointer 1.8 se calienta y el ventilador trabaja pasando los 90 grados mas o menos a los 110 enfría pero después prende a los 120 grados y enfría y después sube hasta los 130 grados y enfría y así hasta encender el testigo de advertencia se le cambio thermoswitch bulbo de temperatura y el indicador de temperatura , radiador , bomba de agua banda de accesorios y hace lo mismo con termostato o sin el no burbugea el deposito ya lo purgue varias veces si alguien tiene alguna idea ke me pueda ayudar se los agradecería bastante :) gracias por su atencion
Viko rivas de México hace 3 años  
IPXSPX de México hace 3 años
Ok, tengo la teoría de que le pones agua a tu radiador... De ser así, ese es el problema. La temperatura operativa normal del Pointer fluctua alrededor de los 100° C. Es el grado en el que el agua se evapora y deja de servir para "bajar la temperatura" ya que se convierte en vapor. Lo que debes hacer es ponerle un buen refrigerante que te pueda aumentar el punto de ebullición del líquido a por lo menos unos 125° C, de esa manera el agua circulará normalmente y mandará la temperatura correcta al bulbo del ventilador.
Viko rivas de México hace 3 años
Siempre eh usado anticongelante lo juro :)
Viko rivas de México hace 3 años
Yo tengo la idea de ke tal vez el empaque este tapado de algún sarro pero la verdad no encuentro ke pudiera estar pasando no se ke. Mas checar
IPXSPX de México hace 3 años
Ok bueno, en primer lugar necesitas ponerlo a trabajar CON termostato... no es posible determinar nada mas si no tuviera el termostato. Si tiene aire acondicionado debería ser de dos velocidades (el primero es a 95° y el 2do a 102° no recuerdo bien)...
Viko rivas de México hace 3 años
Excelente bueno le pondré el termostato nuevamente y te informo muchas gracias
Viko rivas de México hace 3 años
Ha y si tiene clima cuando lo prendo el karro jala muy bien
Jorge de México hace 3 años
Normalmente tambien la falla se soluciona comprando cable grueso y conectarlo del motor a la terminal negativa de la bateria una tierra extra ya que la que tiene no funciona bien.
german de Argentina hace 3 años
No entendi bien jorge eso de conectar un calble grueso a la terminal de la bateria ! ya que no concuerdas con el problema de calentamiento del motor. A yo tambien tengo un pointer 1.8 y el electro me prende a los 92º mas o menos y si lo exigo mucho la temperatura sube a los 110º pero no pasa mas que eso... y graciAS por el dato IPXSPX por q ya me estaba empezando a preocupar por la subida de temperatura de mi auto ya que en otros el electro empieza a funcionar a los 85º
Gegetron de México hace 3 años
German, lo que pasa es que muchos sensores y bulbos trabajan con el principio de que los materiales disminuyen su resistencia a la corriente eléctrica cuando sube su temperatura. Lo que dice Jorge es que tal vez tu sensor ya se ha sobrecalentado demasiadas veces que se quedó en un estado en donde generó gran resistencia y ya no puede variar su temperatura, es decir, ya no cierra el circuito. Si lo conectas directo a la batería eliminas ese problema pero siempre estará prendido, jeje.
ivan de México hace 2 años
Buen dia a todos, oye Viko rivas me gustaria saber al ultimo como fue que solucionaste ese problema de calentamiento, tengo el mismo fallo, mi motoventilador solo prende 5 seg y aunque prende constantemente no es suficiente para que baje la temperatura.

Me levanta temperatura en ruta

Volkswagen Pointer 1996 cli 150000 kms
Hola...buenas...tengo un Pointer 96 cli. Le cambiamos el radiador,bomba de agua,bulbos,mangueras y electroventilador. Todo le tuve q hacer la tapa(se le hizo un plano nada mas)el problema es q se le saco el termostato y el auto a los 5 min ya llega a 80°. No pasa los 90° la temperatura,pero el electro en ruta no se apaga nunca,y estacionado si prende y apaga lo mas bien. Los mecanivos me dicen q es al pedo ponerle el termostato(ya q por lo q lei aca ed indispensable en este motor)tendra algo q ver eso?puede ser q la tapa tenga una fisura?desde ya muchas gracias
edurdo de Argentina hace un año  
Elias de Argentina hace un año
Hola Eduardo tengo el mismo auto y el mismo problema casi idéntico, soy de buenos aires , te paso mi email así te comparto lo todo lo que averigüe, mi auto estuvo funcionando sin termostato pero al final se jodio, no sé si fue por eso , justo hace un rato estaba mirando un vídeo en YouTube acerca de eliminarlo o no.
juanma de Argentina hace un año
Tengo tambien un 96 y estos ultimos dias tambien tuve problemas de temperatura, por mas q prenda directo el electro sigue subiendo, mas en ruta, es muyu raro
matias de Argentina hace un año
Alguien sabe como arreglar este problema yo tambien lo tengo, me calienta en ruta cuando paso los 100 km por hora me sube la temperatura a medida que hacelere, tiene todo nuevo, que puedo hacer''''''''''
guru de Argentina hace 6 meses
Yo no sé ustedes, pero por los comentarios parece que es el motor, el que calienta en demasía y no tanto de refrigeración. Ásí y todo, en ese contexto, podría pasar que la refrigeración no falle pero que sea "chica", para ese motor. El electro, a alta velocidad se mantiene funcionando permanentemente, en los casos presentados?, o se apaga, como sucede normalmente en la mayoría de los autos.

No enciende motoventilador

Volkswagen Pointer 2004 Pointer citi 2004 200000 kms
Hace unos dias, cambie la bomba del agua por que fallo el balero de la misma, tambien cambie una manguera del radiador al motor, al hacer esto encendi el coche y el ventilador no funciona, ya le cambie el sensor azul (señal al motoventilador), revise los fusibles, todo esta en su lugar pero no enciende el ventilador.
Kraven17 de México hace 2 años  
Booster de México hace 2 años
Es posible que sea el sensor de temperatura ya que el ventilador se activa al momento se detectar una temperatura alta
Kraven17 de México hace 2 años
Ya lo cambie, tambien cambie el termostato, el deposito y tapon, cheque los fusibles, solo me faltan los relevadores pero vienen varios y no se cuales sean.
cano06 de México hace 2 años
Estos carros son muy especiales en cuanto al sistema de enfriamiento me pasaba lo mismo hasta que me di cuenta que si todo el sistema de enfriamiento no esta totalmente lleno de anticongelante no entran los abanicos
Asi que para estar seguro te recomiendo que desconectes la manguera de arriba del radiador y por esta misma rellenas hasta el tope luego ponla de nuevo y llena el deposito de anticongelante asi entrara el ventilador. Saludos

Calentamiento de pointer y tira anticongelante

Volkswagen Pointer 2004 city 200000 kms
He revisado las mangueras,cambio de radiador,tapón del deposito del anticongelante,cambio bulbo de radiador,cambio de bomba de agua,y sigue calentándose,sacando el anticongelante por el deposito,podrían ayudarme en este problema ya no se que hacer estoy desesperado. Soy el único dueño lo compre en la agencia y todo es original. Muchas gracias por la asesoría.
SERGIO de México hace 2 años  
ARTURO HERNANDEZ de México hace 2 años
Hola q tal a mi me pasaba lo mismo con mi pointer 2000, se calentaba y empezaba a tirar el anticongelante por la tapa del deposito, la solucion fue en primera cambiar el deposito de anticongelante y en segunda el tapon azul del deposito por q el deposito ya estaba barrida la cuerda y el tapon no retenia la presion del anticongelante caliente es por eso q se salia el anticongelante y obviamente el ventilador no encendia por que la manguera donde va el bulbo de temperatura suiempre se mantenia fria. Pero si cambia el tapon y tambien el deposito y con eso se solucionara tu problema.
LuisLedger de México hace 2 años
Mi auto anda igual... lo estoy revisando yo... descubrí que las mangueras que van conectadas al motor tiene 2 sensores uno negro y el otro azul... encendí el auto y el ventilador no entraba... desconecte el sensor negro y no pasó nada, con un foco probé si está toma tenía corriente y no no tenía electricidad, desconecte el sensor de abajo el azul y entró el ventilador... probe la corriente y no manda nada... revise fusibles y parece que no hay fallas todo funciona... en quincena lo llevaré a revisar con alguien que sepa sobre el tema porque al parecer todo funciona... desde el depósito al radiador... la bomba si hace circular el agua, el ventilador tarda en entrar pero dura muy poco... entonces me temo es una falla delicada eléctrica... nota... el sensor azul la conexión se veía mojada de anticongelante se ve que escurrió... entonces evalúen por partes el problema... y revisen que pasa... porque en mi caso el ventilador estaba apagado y salía mucho vapor del depósito
Responder de México hace un mes
Mi carro tira agua por el tapón del depósito y se calienta mi carro, sera por qué el abanico está dando el aire para el radiador?? Me podrán ayudarme mi carro es Pointer 1998

¿Problemas con un Pointer? Compártelos
Enviar comentarioCancelar
Enviar respuestaCancelar
Síguenos en Facebook

¿Encontraste lo que buscabas?