Problemas y fallas del Ford Ecosport
hay 2245 casos reportados



¿Problemas con un Ecosport? ¡Compártelos y recibe ayuda!

Problemas por categoría

Solucionado
 Ford Ecosport  2009 · Full · 200000 kms
Encontramos un barro gris dentro de la cañeria del agia y no sabemos que es de donde es y como solucionarlo...
NA
NairArgentina
hace 3 meses
Respuestas de la comunidad
Debe ser sarro ,por usar anticongelante diluido con agua, se demonta el deposito y se lava bien con acido y queda limpio nuevamente
hace 3 meses
nairHola... graciass... puede ser el enfriador del aceite...????
Porque es como una pasta gris que se encontraba en el bidon del agua y toda la cañeria...
Y con respecto a limpiarlo... hay que limpiar todo o solo el deposito ???? porque tiene esa pasta gris hasta dentro del radiador???
hace 2 meses
Mejor solución  (según Nair, el autor del problema) 
Mejor solución  (según Nair, el autor del problema) 
Hay que tirar todo el anticongelante , preparar en un recipiente agua purificada y limpiador a base de acetie de pino hasta que quede blanca , agregarla al sistema de enfriamiento como anticongelante , trabajarlo asi varios dias , se repite la operacion hasta que salga el agua transparente ,ya quedo todo el sistema limpio se le pone el anticongelante nuevo
hace 2 meses
Mejor solución  (según Nair, el autor del problema) 

Solucionado
 Ford Ecosport  2006 · 125000 kms
Le cambie las manguera de calefacción desde entonces trabaja normal por unas oras y de repente
Sube arriba de lamiad y no se calentaba antes del cambio
SA
samuelMéxico
hace 3 meses
y otras 6 personas con el mismo problema
Respuestas de la comunidad
Le quedo aire al sistema de enfriamiento ,hay que purgarlo bien
hace 3 meses
Mejor solución  (según samuel, el autor del problema) 
Todavía no lo soluciono por que no se como purgar la manguera
Disculpas porno responder atiempo
hace 2 meses
Mejor solución  (según samuel, el autor del problema) 
Quita la tapa del radiador o del deposito de retorno, enciende el motor, aceleralo moderadamente para recircular el anticongelante 20 min. Aprox. Para que salga el aire que entro al sistema.
hace 2 meses
CarlosHola,t puedo hacer una pregunta tengo un ford orion y se sobre calienta y el agua no circula puede ser que tenga aire ,y lo tnga q purgar la bomba de agua se la cambie !gracias
hace 2 meses
Mejor solución  (según samuel, el autor del problema) 
ricardoEfectivamente, hay que purgar bien el sistema de enfriamiento
hace 2 meses
Mejor solución  (según samuel, el autor del problema) 
Mejor solución  (según samuel, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · Sincronica, 4X2, motor 2.0 · 139000 kms
Buenas tardes, por favor si me pueden ayudar a diagnosticar este problema, iba circulando por una autopista como a 100 kph y se encendieron en el tablero las luces del flotante y la de temperaura, a los pocos segundos se apagaron, la camioneta no presento ninguna falla, pero por las dudas la mande a escanear y no sale ningun problema. NOTA: Le acaban de reparar el alternandor
ME
mesm1976Venezuela
hace 3 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
La bateria ya no aguanto mas. Hay que cambiarla por una de 65 amps. Las que trae de fabrica de 48 amps. Es insuficiente
hace 3 meses
mesm1976La beteria se de 650 amps y solo tiene 7 meses
hace 3 meses
Mejor solución  (según mesm1976, el autor del problema) 
Mejor solución  (según mesm1976, el autor del problema) 
Entonces no quedo bien la reparacion del alternador , regresala al electricista
hace 3 meses
mesm1976Yo pense lo mismo. Gracias
hace 3 meses
Mejor solución  (según mesm1976, el autor del problema) 
Mejor solución  (según mesm1976, el autor del problema) 
Yo tengo el mismo problema ando en la camioneta y de repente se prenden las luces de temperatura y del servicio a motor y cuando se prenden la luz del candado todo el tablero se pone como si estuviera apagada pero luego se acomoda no presenta ningun problema la camioneta que puede ser ??
hace un mes
Mejor solución  (según mesm1976, el autor del problema) 
Si no es la bateria , puede ser que no este identificando el chip de la llave
hace un mes
Mejor solución  (según mesm1976, el autor del problema) 
Como puedo saber si es el chip de la llave, hace unos minutos configure las 2 llaves y si prenden la camioneta eso al candadito, sobre la luz de la temperatura y del engine crees que sea por la bateria?? estaba pensando desconectar un polo de la bateria para ver si se acomada la computadora.
hace un mes
Mejor solución  (según mesm1976, el autor del problema) 
Hazlo ,pero cuando la bateria tiene bajo voltaje empieza hacer esas fallas, si ya tiene mas de año y medio de uso , ya debe estar avisando
hace un mes
koyot3La verdad no se cuanto tiempo tenga la bateria aparentamente se ve nueva poco usoacabo de comprarla, oye y para revisar el chip de la llave como se hace. Otra pregunta del lado copiloto en la salpicadera delantera trae un conector desconectado de que sera, xq no me prende la luz de los abs.
hace un mes
Mejor solución  (según mesm1976, el autor del problema) 
Mejor solución  (según mesm1976, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 131245 kms
Hola hoy cambie la bateria y en la radio me pide un código. No tengo manual ya que no venia en la eco
VI
Victor 2007Chile
hace 3 meses
y otras 7 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2007 · 60000 kms
Hola!!! Tengo una ecosport 2007 y últimamente cuando tengo el radio, las luces, el aire acondicionado y los limpiadores un buen tiempo, al apagarla y querer arrancarla casi enseguida, no arranca hace lo mismo como cuando se queda sin batería, la diferencia esta que al apagar las luces, el radio, los limpiadores y el aire acondicionado, y dar marcha sorpresa prende a la primera; mi duda recae en si es el alternador??? O simplemente la batería???
RU
RubyMéxico
hace 3 meses
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Es un defecto de diseño de fabrica ford, le pone una bateria insuficiente 48 amps. Para el equipamiento que le pone a la ecosport. La solucion definitiva es cambiarla por una de 65 amps. Otros ya lo han hecho y solucionaron ese defecto
hace 3 meses
RubyMuchas gracias cambiare la batería y ya les contaré como me fue!!!
hace 3 meses
Mejor solución  (según Ruby, el autor del problema) 
Mejor solución  (según Ruby, el autor del problema) 
H-42-550 LTH

Linea: Hi-TEC
Placas por celda: 12 Voltios
Arranque 18c: 550 Amperios
Capacidad Reserva: 95 Minutos
Polaridad: (-)/(+)
Garantia: 60 meses
12 meses reemplazo sin costo
Garantía servicio público: ver póliza
Bci: 42
CA : 687 Amperios
hace 3 meses
Mejor solución  (según Ruby, el autor del problema) 

Solucionado
 Ford Ecosport  2014 · Friestile · 70000 kms
Hola gente quiero saber si alguien sabe como reconfigurar el arranque de la ecosport...el problema q tuvo es q se le perdió el chip de la llave...le daban arranque y nada...después encontraron el chip y ahora para q arranque hay q pisar freno y embrague...siendo q antes solo el embrague...q se puede hacer en estos casos?? gracias
FA
FacuArgentina
hace 3 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Usar el duplicado de la llave o mandar hacer una llave nueva y programar el chip con un cerrajero automotriz
hace 3 meses
Mejor solución  (según Facu, el autor del problema) 
Muchas gracias...un abrazo
hace 3 meses
Mejor solución  (según Facu, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 5 puertas · 175000 kms
Le cambie casi todo me refiero a :revisión de tapa cilindro,cambie pieza completa de termostato,bomba de agua,deposito de agua y tapa nueva y revisión del radiador todo vien y sigo con problema de que se sube la temperatura que mas hago...
PE
Pelr.Chile
hace 3 meses
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Es un defecto de diseño de fabrica de FORD , hay que cambiarle la polea de la bomba de agua a una mas chica para que tenga mas rpm y recircule mas eficientemente el anticongelante.
hace 3 meses
Mejor solución  (según Pelr., el autor del problema) 
Luis Sanchez
Gracias ya solucione el problema con la polea, saludos a todos.
Responder
Hace 3 meses
hace 3 meses
Mejor solución  (según Pelr., el autor del problema) 
Estimados: quisiera su ayuda y recomendación de un mecánico para mi eco, no se donde llevarla con confianza si ustedes me pueden dar un dato se los agradecería, la eco la compre usada es el primer vehículo que tengo como referencia es del año 2005, motor 1.6, y tiene 103.000 km y hoy al llegar a mi destino pare el motor y note que el refrigerante del deposito del radiador estaba hirviendo, en ningún momento sobre la marcha me mostro un mensaje o algo en el panel y el termómetro del mismo panel se mantuvo en el medio normal, nunca indico un aumento de temperatura, la deje enfriar pero no se que mas hacerle y no se tampoco donde llevarla aun no tengo un mecánico. :( que hago...
hace 3 meses
Mejor solución  (según Pelr., el autor del problema) 
Si no subio temperatura, es la tapa del radiador que no sella , fuga presion y anticongelante al deposito de retorno, consiguela de las mismas libras de presion de la original
hace 3 meses
Mejor solución  (según Pelr., el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 4 puertas · 8800 kms
Estamos teniendo dificultades para entrar el primer cambio, y cuando llegamos al tercer cambio si pasamos de 60km/h y 3rpm se dispara y vuelve a neutro
FO
fordecoColombia
hace 3 meses
Respuestas de la comunidad
Revisa el varillaje del selector de velocidades.
hace 3 meses
Mejor solución  (según fordeco, el autor del problema) 
Solucionado
 Ford Ecosport  2010 · 133 kms
Puede ser q se apaga el motor o no regula q sea la bobina
TI
tinchoArgentina
hace 3 meses
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Revisa la valvula iac (valvula de aceleracion minima) esta oculta detras del multiple, puede estar sucia ,se lava con limpiador w 40 , si no mejora hay que cambiarla por otra original.
hace 3 meses
FabianHola necesito ayuudaaaa urgente necesito saber que sera porque no le cargue nafta tengo una ford ecosport y ahora no arranca mas y no se que sera me podrian ayudaar urgenteeee
hace 2 meses
Mejor solución  (según tincho, el autor del problema) 
EiverSi no suenq la bomba revise el fusible,el relay,o el interructor de corte de combustible ubicado debajo del tablero de instrumentos lado del pasajero
hace 2 meses
Mejor solución  (según tincho, el autor del problema) 
Mejor solución  (según tincho, el autor del problema) 
Al conectar la llave en ON (sin encender ) se escucha el zumbido de la bomba de gasolina ? si no se escucha revisa le fusible y el reele de la bomba de gasolina que esta en la caja de fusibles en el motor, en la tapa esta la ubicacion y servicio.
hace 2 meses
Mejor solución  (según tincho, el autor del problema) 

Solucionado
 Ford Ecosport  2004 · TDCI · 121000 kms
Buenss tardes. Les comento que hace unos meses en mi ecosport tdci 2004. Se paso el aceite al agua. Como primer medida se cambio el radiador de aceite, y el problema continuó. Lo lleve a otro mecanico y se le hizo la tapa, y se limpio todo el circuito. A los dias, en una subida no muy pronunciada calento mucho quemando el protector de alfombra que tiene el motor por detras del radiador, al abrir el deposito de agua notamos que no tenia agua. Por lo que le agregamos y continuamos camino sin dificultad. Al dia siguiente se lo vuelvo a llevar al mecanico y en ese trayecto le senti mucho olor a di…Leer completa
FE
FernandoArgentina
hace 3 meses
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Saliendo del mecanico, a pie por supuesto. Paso a describir:
No es aceite al agua, ni agua al motor, pero no se sabe donde va a parar el agua del deposito. Tampoco sale agua por el caño de escape.
Una de las mangueras que lleva el agua esta fria. La otra caliente, y retorna el agua con ollin, no es aceite de motor. Las manchas debajo de la canioneta es diesel. Por otro lado hay un cable que conecta la bateria con los fusibles que se calienta bastante. El motor en funcionamiento viene parejo y cada tanto quiere hacer como un corte. Katrina de chanes. La eco TDCI es el peor auto que jamas tuve, pero a seguir remando.
hace 3 meses
Mejor solución  (según Fernando, el autor del problema) 
Hola ami me paso algoo mas o menos iguall mi camioneta le hice la afinacion antes de salir de viaje y ya de regreso me marcaba que no tenia aceite en un trayecto de 321 kilometros mas o menos tuve que echarle 7 litros de aceite y me la checaron y me comentan que no la tira solo la quemaa.
hace 3 meses
Mejor solución  (según Fernando, el autor del problema) 
Buenas tardes
Tengo una eco 2004, le acaban de hacer la afinacion, pero un detalle trae un olor tipo gasolina o aceite quemado, eso pasa cuando la usa todo el dia,
Tambien en la mañana la prendo para que se caliente y humea ya despues de 10 min ya no solamente en la mañana me puedes ayudar
hace 3 meses
Mejor solución  (según Fernando, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 4 puertas estándar electrica · 150000 kms
Buenos días tengo un problema con mi eco los síntomas son, la enciendo por las mañanas y enciendo bien pero a los 3 minutos empieza un corcoveó del motor como tirando a apagrase de ves en cuando se apaga y cuando la acelero se escucha un ruido de tuc tuc cerca del filtro de aire me dicen q puede ser la iac, ya la limpie tambien se lavo el cuerpo de aceleración y cuando pasa todo esto la aguja de las rpm osila en lo minimo osea sube y baja pero en lo minimo despues le doy un acelern y regresa a la normalidad pero al ratito otra vez, otro es q cuando quiero salir de golpe o rebasar no hay potencia,
OS
OscaritoMéxico
hace 3 meses
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Estoy presentando el mismo problema y es que cuando se destabiliza el motor en minimo es porque deja de funcionar un cilindro en micaso es el 3 y suena asi mismo como dices tac tac tac y cuando acelero se le quita tambien se apagaba en minimo y le cambie la bujia y ya no se apaga e llegado a pensar que cuandofalla es porque cae agua de la empacadura al cilindro y moja la bujia ya que al acelerarlo no falla solo falla en minimo y en algunas ocasiones cuando necesito arrancar rapido
hace 3 meses
Mejor solución  (según Oscarito, el autor del problema) 
Revisa las bujias del motor el sonido y la falla que estas presentando cuando se desestabiliza en minimo es porque deja de funcionar un cilindro
hace 3 meses
Mejor solución  (según Oscarito, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 4 puertas standat · 165000 kms
Tengo una ecosport 2004 no me a fallado pero cuando estoy andando y bajo ameter la primer velocidad chilla algo y la segunda igual... no se apaga no nada entra pero chilla como. Que algo no enbona pero entra mepodrian ayudar saludos desde cancun
MA
Manuel México
hace 3 meses
Respuestas de la comunidad
Revisa el varillaje del selector de velocidades
hace 3 meses
Mejor solución  (según Manuel , el autor del problema) 
Aparentemente tienes desgaste en los bronces de 1ra y 2da segunda son los que se encargan de frenar el piñon para evitar ese sonido que estas escuchando de seguro solo escuchas ese sonido cuando estas recojiendo las velocidades de mayor a menor si fuera otro el problema incluyendo el varillaje el sonido fuera constante cada vez que introdujeras 1ra y segunda para arrancar
hace 3 meses
Mejor solución  (según Manuel , el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 2.0 4x2 · 145690 kms
Hola amigos tras la armada reciente del motor después de ser anillado mi ecosport no tiene fuerza el primer cilindro no funciona y al llegar a 3000 revoluciones pareciera que tengo una matraca tracacacacacacacacacacacacacacacacaacacacacacacacacacacaca alguien que me de su opinion por favor...de paso el mecánico se convirtió en mago... desapareció el desgraciado...
IR
irwingVenezuela
hace 3 meses
Respuestas de la comunidad
Valvulas de la tapa de compresion enciende el motor y trata de tapar con un carton el escape si succiona el carton tienes problemas con las valvulas
hace 3 meses
Mejor solución  (según irwing, el autor del problema) 
Sin mucho probar el problema alli son valvulas dobladas
hace 2 meses
Mejor solución  (según irwing, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 160 kms
Tengo una ford ecosport... cuando la revolucion llega a 4.5 vuelta el motor corta y no deja revolucionar mas y corcovea, ademas el contador de velocidades no marca, queda en cero... me dijeron que puede ser el sensor de velocidad...

Alguien que me de su comentario de lo que pueda estar sucediendo...

Grac
RE
renneVenezuela
hace 3 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Revisa el sensor de velocidad y el arnes de conexión ,esta en la transmision. Mientras no marque el velocimetro no funcionara normal.
hace 3 meses
Mejor solución  (según renne, el autor del problema) 
Podrias estar presentando problema con el tps desconecta el conector y prueba si se elimina la falla replaza el tps esta ubicado debajo de donde llega la gualla de acelerador
hace 3 meses
yeffersonAmigo mi ecoesport tenia el mismo problema y le monte el sensor de velocidad y listo problema resuelto. Compralo y montalo nuevo.
hace un mes
Mejor solución  (según renne, el autor del problema) 
Mejor solución  (según renne, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · 88000 kms
Buenas tarde tengo una ecosport me salta la primera la lleve al mecanico tres veces y sigue lo mismo primero cambie los cables ,seguia el mismo problema. Vajaron la caja cambio engranaje de primera y sigue igual que podra ser
AL
albertoArgentina
hace 3 meses
Respuestas de la comunidad
En el 2011 empezaron a usarlas en el fiesta y focus ,ya la estan montando en todas sus unidades a pesar de presentar multiples fallas y defectos. La transmisión Powershift de Ford es la apuesta de la marca para bajar tanto el consumo de combustible y la emisión de gases contaminantes en sus autos nuevos, más específicamente en los modelos Fiesta y Focus de nueva generación. Esta caja automática robotizada, utiliza la tecnología de doble embrague –o clutch- que también utilizan otras marcas, sólo que ésta es más compacta y ofrece algunas otras ventajas que detallaremos más adelante.
¿Cómo funciona?
Esta parte puede ser un poco tediosa, pero trataremos de hacerlo de la manera más amena posible para describir su funcionamiento. Todas las transmisiones modernas –automáticas o manuales- cuentan con dos trenes de engranes, uno para las velocidades pares (2ª, 4ª y 6ª) y otro para las nones (1ª, 3ª y 5ª). Estos trenes reciben el torque del motor mediante el disco del volante inercial (que a la vez está conectado al cigüeñal que a su vez recibe el impulso de los pistones) pero para cambiar entre un tren y otro, el embrague separa momentáneamente un tren para engranar el otro. Esta tarea se puede realizar mecánicamente (transmisiones manuales), hidráulicamente (transmisiones automáticas convencionales) o eléctricamente (transmisiones robotizadas) pero al contar con un solo clutch o embrague, la tarea es más lenta. Aquí es donde las transmisiones de doble embrague entran en acción pues al tener un embrague para cada uno de los trenes se pueden separar las tareas de desacoplamiento y acoplamiento para cada uno de ellos, logrando que los cambios sean prácticamente instantáneos. La forma en que lo hace es la siguiente: suponiendo que el auto arranca en primera velocidad, el usuario acelera hasta que el motor llega a un determinado número de rpm (dependiendo de la situación y cuánto está presionando el conductor el pedal del acelerador, pueden ser más o menos revoluciones por minuto del motor), entonces la computadora manda la señal a los motores eléctricos de la transmisión Powershift y al mismo tiempo que el clutch para las velocidades nones (1ª, 3ª y 5ª) desacopla el tren de éstas, el otro embrague acopla el tren de las velocidades pares (2ª, 4ª y 6ª). Todo esto sucede en fracciones de segundo así que el motor prácticamente se mantiene en la misma curva de torque y no tiene que volver a empezar desde abajo para recuperar el impulso. Esto se traduce en un mejor aprovechamiento de la energía del motor, un menor consumo de combustible y menor producción de gases contaminantes.
Otras ventajas de esta transmisión son las siguientes:
-Gracias al diseño compacto y a la falta de sistema hidráulico, la Powershift ahorra 70 kg en el peso total del auto (menos componentes y menos fluidos). -La caja es más compacta gracias a los actuadores electromecánicos que sustituyen a los hidráulicos para mover los trenes de velocidades, esto le permite ocupar menos espacio bajo el cofre y acomodar más fácilmente los demás componentes del motor. -La transmisión viene sellada de fábrica, gracias a que el único fluido que contiene es el que lubrica la parte interna, además los actuadores que mueven los trenes de velocidades son eléctricos convirtiéndola en una transmisión libre de mantenimiento por hasta 10 años. -Gracias a que los embragues son controlados por una computadora y no por un humano, la vida de las pastas se prolonga mucho más, así que el clutch se cambia cada 10 años en un escenario óptimo.
Como todo, también existe un lado negativo o por lo menos algunos detalles que se podrían traducir por el usuario como fallas o comportamientos extraños. Éstos son algunos de ellos y sus causas:
-Al ser una transmisión manual robotizada, Powershift no cuenta con fluido hidráulico para su funcionamiento, sólo el aceite que lubrica internamente, entonces los ruidos que se producen al acoplar y desacoplar las velocidades se hacen más evidentes. En una transmisión automática convencional, el fluido y el mismo sistema aíslan estos ruidos. -Al apagar el motor, la transmisión tiene que prepararse para cuando el auto se vuelva a encender, así que en algunas ocasiones se pueden escuchar ruidos de la transmisión aunque el motor se haya apagado. No es ninguna falla, sino que la Powershift se está moviendo internamente para quedar en una posición ideal para el arranque. -Como su accionamiento es más parecido al de una transmisión manual que al de una automática convencional, la Powershift de Ford puede provocar que el auto se mueva hacia atrás cuando el freno no se aplicó y el sistema de ayuda en pendientes no frenó el auto, tal como lo pasaría con una caja manual. Es cuestión de acostumbrarse pues bajo ninguna circunstancia el auto avanzaría mucho, antes el sistema entra en acción y engrana la primera velocidad o la reversa según sea el caso.
Ford está continuamente trabajando para mejorar el funcionamiento de la Powershift y aislar los ruidos que se producen durante los cambios o los raros casos en los que se llega a calentar el sistema. Aproximadamente, dos o tres veces al año se realizan ajustes en la programación de la computadora de la transmisión y cada que el usuario lleva su auto a la agencia para servicio, se actualiza el software de la transmisión a la versión más reciente. Son defectos de diseño de transmisiones de fabrica de ford. Que no termina de perfeccionar, por lo que aumento a 10 años de garantia. Llevalo al distribuido ford
hace 3 meses
Mejor solución  (según alberto, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · 85000 kms
Hola amigos mi Eco siempre anduvo bien pero hace unos días se empezó a prender la luz amarilla y el motor empieza a no tirar nada especialmete si voy a baja velocidad y comienza a fallar el modulador de aceleracion
CA
CarollArgentina
hace 3 meses
y otras 13 personas con el mismo problema
Respuestas de la comunidad
Si es la bateria que trajo de fabrica , debe ser que ya requiere cambiarse. Antes que ya no funcione nada.
hace 3 meses
Mejor solución  (según Caroll, el autor del problema) 
Hola a todos, gracias por las sugerencias, hice revisar la batería y también le puse líquido de limpieza de inyectores pero pese a ello la luz sigue titilando en algunas ocasiones. Si logro solucionar el problema lo daré a conocer.
hace 2 meses
Mejor solución  (según Caroll, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 180000 kms
Hola buenas noches soy nuevo acá... quería comentar un problema que estoy teniendo con mi ecosport el cual ya tiene tiempo así el problema es que taquetea mucho al prenderla al acelerar siempre suena... muchos me dicen que es la cadena de tiempo otros que los taquetes en realidad quisiera que me ayudaran para tener una certeza de lo que será para no hacer un gasto en vano...
AL
alanVenezuela
hace 3 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Si le estas poniendo aceite 15w 40 esa es la causa. Ya que lleva aceite 5w 30 si hay clima templado y 5w 40 si es calido.
hace 3 meses
Mejor solución  (según alan, el autor del problema) 
El problema que presenta tu vehiculo es que no esta en el tiempo se movio el tiempo o alguna vez cambiaron la estopera del motor y no lo pusieron a tiempo si este motor si es duratec 2.0 no utiliza taquetes utiliza puentes de valvula completamente mecanico tambien podria ser que la cadena este estirada y haya que graduar el tensor de la cadena ese motor trabaja perfectamente con 15w40
hace 3 meses
Mejor solución  (según alan, el autor del problema) 
Solucionado
 Ford Ecosport  2015 · Titanium · 30000 kms
De repente me comenzó a aparecer en la pantalla cada vez que la prendo el siguiente mensaje : " Sistema de frenos averiado por favor pare con cuidado".
Antes de llevarlo al concesionario quisiera saber si a alguien en el foro le ha sucedido lo mismo y cual fue su diagnóstico para que no me vayan a cobrar esta vida y la otra. Gracias
AA
AalayonColombia
hace 3 meses
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Tiene garantia de fabrica , ademas de multiples fallas de fabricacion ,sobre todo las titanium, exige el servicio de garantia sin costo
hace 3 meses
andrLa mia no tiene garantia ???
hace 3 meses
Mejor solución  (según Aalayon, el autor del problema) 
Mejor solución  (según Aalayon, el autor del problema) 
La garantia de fabrica ford es de 3 años o 60,000 km. y en tramsnisiones automaticas power shift 2011 en adelante 10 años de garantia igual por muchos defectos de diseño y funcionamiento
hace 3 meses
Mejor solución  (según Aalayon, el autor del problema) 
Solucionado
 Ford Ecosport  2009 · XLS 1.6 · 98000 kms
Hola, tengo una Ecosport 2009 de 0 km con 98000 km y recién mi primer problema, resulta que dejó de funcionar el velocímetro y el odometro quedo con rallitas, así dos dias hasta que me apareció marcado el indicador de un motor,compre un sensor de velocidad nuevo marca valeo ($750) y lo lleve al mecánico que le hizo un escaneo ($1200), el motorcito se soluciono , pero sigo sin velocímetro ni odometro , y el escaneo da que el tablero está bien, y el conector del sensor tiene corriente, ya no sé qué hacer, gracias
AL
AlfredoArgentina
hace 3 meses
y otras 8 personas con el mismo problema
Respuestas de la comunidad
Tiene que ser sensor original , el generico no lo reconoce la computadora.
hace 3 meses
Mejor solución  (según Alfredo, el autor del problema) 
Hola tengo una ecospot 2010 y el cuenta vuelta me dejo de funcionar de por rato si y de por rato anda no se que le pasa y no me marca los kilometros cuando de de funcionar y el cierre centralizado tarda en cerrar las puertas en movimiento
hace 2 meses
Mejor solución  (según Alfredo, el autor del problema) 
Hola tengo una eco sport 2008, hace 1 mes aproximadamente el indicador de Kilometraje dejo de marcar los kilometros recorridos, no quedo en blanco total si no que aparecen los numeros entre cortados y no se entienden para nada, alguna solucion?
hace un mes
Mejor solución  (según Alfredo, el autor del problema) 
Cambiar el display del odometro.
hace un mes
Mejor solución  (según Alfredo, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 2.0 xlt full · 200000 kms
Prende la luz del check a nafta o gas, y luego se pone en tres cilindros, tiene buena compresión el motor, pareciera algo eléctrico pero el sanear no larga ninguna falla...pero falla
JA
JAF71Argentina
hace 3 meses
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Se corrige sola, dura poco hasta una pendiente leve, repite el cuadro...la paro y arranca bien en cuatro cilindros
hace 3 meses
ricardoEn el 2011 empezaron a usarlas en el fiesta y focus ,ya la estan montando en todas sus unidades a pesar de presentar multiples fallas y defectos. La transmisión Powershift de Ford es la apuesta de la marca para bajar tanto el consumo de combustible y la emisión de gases contaminantes en sus autos nuevos, más específicamente en los modelos Fiesta y Focus de nueva generación. Esta caja automática robotizada, utiliza la tecnología de doble embrague –o clutch- que también utilizan otras marcas, sólo que ésta es más compacta y ofrece algunas otras ventajas que detallaremos más adelante.
¿Cómo funciona?
Esta parte puede ser un poco tediosa, pero trataremos de hacerlo de la manera más amena posible para describir su funcionamiento. Todas las transmisiones modernas –automáticas o manuales- cuentan con dos trenes de engranes, uno para las velocidades pares (2ª, 4ª y 6ª) y otro para las nones (1ª, 3ª y 5ª). Estos trenes reciben el torque del motor mediante el disco del volante inercial (que a la vez está conectado al cigüeñal que a su vez recibe el impulso de los pistones) pero para cambiar entre un tren y otro, el embrague separa momentáneamente un tren para engranar el otro. Esta tarea se puede realizar mecánicamente (transmisiones manuales), hidráulicamente (transmisiones automáticas convencionales) o eléctricamente (transmisiones robotizadas) pero al contar con un solo clutch o embrague, la tarea es más lenta. Aquí es donde las transmisiones de doble embrague entran en acción pues al tener un embrague para cada uno de los trenes se pueden separar las tareas de desacoplamiento y acoplamiento para cada uno de ellos, logrando que los cambios sean prácticamente instantáneos. La forma en que lo hace es la siguiente: suponiendo que el auto arranca en primera velocidad, el usuario acelera hasta que el motor llega a un determinado número de rpm (dependiendo de la situación y cuánto está presionando el conductor el pedal del acelerador, pueden ser más o menos revoluciones por minuto del motor), entonces la computadora manda la señal a los motores eléctricos de la transmisión Powershift y al mismo tiempo que el clutch para las velocidades nones (1ª, 3ª y 5ª) desacopla el tren de éstas, el otro embrague acopla el tren de las velocidades pares (2ª, 4ª y 6ª). Todo esto sucede en fracciones de segundo así que el motor prácticamente se mantiene en la misma curva de torque y no tiene que volver a empezar desde abajo para recuperar el impulso. Esto se traduce en un mejor aprovechamiento de la energía del motor, un menor consumo de combustible y menor producción de gases contaminantes.
Otras ventajas de esta transmisión son las siguientes:
-Gracias al diseño compacto y a la falta de sistema hidráulico, la Powershift ahorra 70 kg en el peso total del auto (menos componentes y menos fluidos). -La caja es más compacta gracias a los actuadores electromecánicos que sustituyen a los hidráulicos para mover los trenes de velocidades, esto le permite ocupar menos espacio bajo el cofre y acomodar más fácilmente los demás componentes del motor. -La transmisión viene sellada de fábrica, gracias a que el único fluido que contiene es el que lubrica la parte interna, además los actuadores que mueven los trenes de velocidades son eléctricos convirtiéndola en una transmisión libre de mantenimiento por hasta 10 años. -Gracias a que los embragues son controlados por una computadora y no por un humano, la vida de las pastas se prolonga mucho más, así que el clutch se cambia cada 10 años en un escenario óptimo.
Como todo, también existe un lado negativo o por lo menos algunos detalles que se podrían traducir por el usuario como fallas o comportamientos extraños. Éstos son algunos de ellos y sus causas:
-Al ser una transmisión manual robotizada, Powershift no cuenta con fluido hidráulico para su funcionamiento, sólo el aceite que lubrica internamente, entonces los ruidos que se producen al acoplar y desacoplar las velocidades se hacen más evidentes. En una transmisión automática convencional, el fluido y el mismo sistema aíslan estos ruidos. -Al apagar el motor, la transmisión tiene que prepararse para cuando el auto se vuelva a encender, así que en algunas ocasiones se pueden escuchar ruidos de la transmisión aunque el motor se haya apagado. No es ninguna falla, sino que la Powershift se está moviendo internamente para quedar en una posición ideal para el arranque. -Como su accionamiento es más parecido al de una transmisión manual que al de una automática convencional, la Powershift de Ford puede provocar que el auto se mueva hacia atrás cuando el freno no se aplicó y el sistema de ayuda en pendientes no frenó el auto, tal como lo pasaría con una caja manual. Es cuestión de acostumbrarse pues bajo ninguna circunstancia el auto avanzaría mucho, antes el sistema entra en acción y engrana la primera velocidad o la reversa según sea el caso.
Ford está continuamente trabajando para mejorar el funcionamiento de la Powershift y aislar los ruidos que se producen durante los cambios o los raros casos en los que se llega a calentar el sistema. Aproximadamente, dos o tres veces al año se realizan ajustes en la programación de la computadora de la transmisión y cada que el usuario lleva su auto a la agencia para servicio, se actualiza el software de la transmisión a la versión más reciente. Son defectos de diseño de transmisiones de fabrica de ford. Que no termina de perfeccionar, por lo que aumento a 10 años de garantia. Llevalo al distribuido ford
hace 3 meses
Mejor solución  (según JAF71, el autor del problema) 
Mejor solución  (según JAF71, el autor del problema) 
Solucionado
 Ford Ecosport  2003 · Xl 1.6  · 213000 kms
Tengo problema de arranque , le mandé a cambiar los carbones al burro y arranca pero cuando uso la camioneta y después paro y quiero volver a poner en marcha no arranca y tengo que esperar unos 15 minutos como que se enfriara. Que podría ser ?
LE
LeanArgentina
hace 3 meses
y otras 15 personas con el mismo problema
Respuestas de la comunidad
-2
Sensor de temperatura o anticongelante vencido , se debe cambiar cada 40,000 km. o 2 años de uso
hace 3 meses
Mejor solución  (según Lean, el autor del problema) 
-2
Tienes problemas con el automatico del arranque
hace 3 meses
Mejor solución  (según Lean, el autor del problema) 
-1
Ya le cambie el sensor le puse uno original. Le puse anticongelante , al burro lo mande l electricista y lo arreglo todo. Esta nuevo pero sigue la falla que puede ser ?porque pone le la ando 10 minutos y. Cuando la arranco enciende enseguida , pero ya cuando l ando un rato y la paro y quiero darle arranque no enciende , y tengo que esperar que se enfríe un rato y ahí le doy arranque. Y enciende enseguida me podrían ayudar ?ya no se que hacer
hace 3 meses
Mejor solución  (según Lean, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · 150000 kms
De pronto un ruido fuerte de chillido de correa, le cambio la polea y el tensor el ruido sigue y el mecanico dice que debo ponerle una polea de media pulgada mas o colocarle una correa una pulgada menos...pero todo sigue igual con el chillido.
DO
DORYSVenezuela
hace 3 meses
Respuestas de la comunidad
Revisa la polea del alternador , hay unas que traen un embrague y cuando se rompe puede frenarse y ocasionar el chillido
hace 3 meses
Mejor solución  (según DORYS, el autor del problema) 
Amigo yo reparo alternadores y estoy totalmente seguro que son las rolineras del alternador... ya están malas y se trancan al momento de girar a por consiguiente para la polea y al deslizar la corea suena ese chillido
hace 3 meses
Mejor solución  (según DORYS, el autor del problema) 
Ya se revisaron las poleas y nada alguien me dice que pueden ser los soportes del motor...esto me tiene en la locura
hace 3 meses
Mejor solución  (según DORYS, el autor del problema) 
Con el motor funcionando hechales agua a la correas , si se calla son las bandas que estan gastadas o sueltas.
hace 3 meses
Mejor solución  (según DORYS, el autor del problema) 
Solucionado
 Ford Ecosport  2014 · ecosport 2.0 kinetic · 64000 kms
Cuando llegue a los 55000 km descubri debajo de las dos butacas de adelante que estaba humedo y hasta mojado, hice revisar el aire y el calefactor con resultado negativo por suerte. Luego se seco y el finde anterior que llovio anduve bastante y nuevamente encuentro humedo las dos butacas las lleve a revisar y el instrumentista me afirma que por algun lugar ingresa agua de lluvia, a alguien le paso algo parecido, alguien me puede ayudar. Gracias. Aldo
AL
aldoArgentina
hace 3 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Debe de estar obstruido el dren de la rejilla debajo del cristal panoramico, se acumula agua y pasa por el sistema de ventilacion al interior
hace 3 meses
aldoJuan me hablastes la primera, pregunto donde esta la goma trasera de la compuerta, y que compuerta? y me falta de que me hables de la segunda idea. Gracias.
hace 3 meses
Mejor solución  (según aldo, el autor del problema) 
aldoRicardo te cuento en esa rejilla debajo del cristal panoramico tira un balde de agua y la misma se escurre normalmente por debajo de la camioneta. Creo que el drenaje funciona normal. Si estamos en la misma rejilla confirmame, sde lo contrario abundame mas respuesta. Gracias
hace 3 meses
Mejor solución  (según aldo, el autor del problema) 
Mejor solución  (según aldo, el autor del problema) 
Tengo 2 ideas que puedes verificar la primera si tienes aire acondicionado que el desague del evaporador o la goma trasera de la compuerta este mal ajustada te explico como se ajusta la quitas completa y la ranura que entra en la carroceria la ajustas con los dedos pulgar e indice en pocas palabras cierras un poco la ranura que entra en la orilla de la carroceria y luego lo instalas y veras que solucionas tu problema
hace 3 meses
Mejor solución  (según aldo, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 4puertas,full,motor · 15000 kms
Alguien me puede decir cual seria la falla cuando el nivel de temperatura y de la gasolina se empiezan a mover y arranca y luego se apaga xf
JO
JorgeMéxico
hace 3 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Debe ser la bateria ya no retiene carga, llevala a un centro de servicio lth a diagnostico electronico , es sin costo
hace 3 meses
Mejor solución  (según Jorge, el autor del problema) 
Si se apaga y le das a prender automaticamente queda descartada la bateria revisa las bujias
hace 3 meses
kratosPosible mente puede ser un filtro sucio que le niega gasolina...
hace 2 meses
Mejor solución  (según Jorge, el autor del problema) 
Mejor solución  (según Jorge, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 95850 kms
Sube la temperatura a mas de la mitad el motoventilador empieza a funcionar después de que la temperatura esta ala mitad ya le cambie el sensor de temperatura
GO
GonzalezMéxico
hace 3 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
La ecosport trabaja siempre con la temperatura a la mitad revisa los relays que controlan el electro, estan abajo directamente bajo el electroventilador
hace 3 meses
Mejor solución  (según Gonzalez, el autor del problema) 
Debes verificar que este trabajando la velocidad baja del electro enciende el vehiculo y desconecta el sensor de temperatura y observa que encienda la velocidad baja y luego de 3 segundos encienda la velocidad alta si no esta encendiendo la velocidad baja de tu electro ese es el problema este vehiculo utiliza 2 relay uno para la velocidad baja del electro y otro para la velocidad alta del electro estan ubicados en lado izquierdo del mismo lado que la bateria al lado de la cajera del radiador parte inferior
hace 3 meses
Mejor solución  (según Gonzalez, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · titanium 2.0 · 56000 kms
Hola, lleve la eco al service de 60mil para cambiar las bujías y me dicen q la #1 esta trabada, q si le hacen fuerza se puede romper y si sucede esto deben sacar la tapa de cilindro y cambiar juntas, etc. El tema es q los mismos del concesionario me dicen q es una falla de fábrica del motor 2.0, q ya les paso y no saben a q se debe, puede ser agua en el cilindro de la bujía y x eso se "agarra" no la pueden sacar para el cambio. Es realmente cierto, alguien tuvo algo similar, lo cubre la garantía.
EC
Eco2013Argentina
hace 3 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Los ford estan trayendo muchos defectos de fabricacion , mas los modelos TITANIUM
hace 3 meses
Mejor solución  (según Eco2013, el autor del problema) 
Le pusieron un producto para q ablande, volvi a los 10 días y la pudieron sacar, ahora me dijeron q el problema era q le entraba agua del exterior, q se acumulaba en la rejilla abajo del parabrisas y como se tapaba un desagote rebalsaba sobre la bujía y x eso se agarraba, muy raro todo, jamás sabré cual es realmente el problema, la primera vez me dijeron q no era agua del exterior, ahora si...
hace 2 meses
Mejor solución  (según Eco2013, el autor del problema) 
Solucionado
 Ford Ecosport  2014 · 72000 kms
Quiero dar las gracias de que existe este foro, el cual ha permitido que se aclaren muchas dudas con respecto ha esta falla que arroja el sistema ABS,, Tengo la Ford Ecosport año 2014 con 70000 Km y se presento este problema, el cual con se le hizo puente y encendió inmediatamente y desapareció la falla, hoy partió sin ningún problema, igual compro una batería nueva. Espero que estas grandes empresas se den el tiempo de leer este foro y tomen conciencia que al abaratar sus costos nos hacen un perjuicio a nosotros como consumidores. Gracias amigos.
JU
Juan CarlosChile
hace 3 meses
y otras 6 personas con el mismo problema
Respuestas de la comunidad
Juan Carlos hoy me sucedió esto, me dejó botado en panamericana hacia el sur por la caletera, es exactamente lo mismo que me sucedió, Ford Ecosport 2015, más en mi caso me asusté por el tema del ABS y llamé a una grúa para tirarlo al concesionario de la Summit donde lo compré, por lo menos sé ahora que debiese ser un tema de batería y así no podrán meterme el dedo en la boca (una vez más)
hace 3 meses
Mejor solución  (según Juan Carlos, el autor del problema) 
Jose,
Hoy en la tarde compro la batería, si consulte por la de 75 amperes y en todos los servicios me respondieron que no sirve porque el soporte es mas pequeño donde encaja la batería, por el tamaño me recomendaron la de 60 amperes
hace 3 meses
Mejor solución  (según Juan Carlos, el autor del problema) 
Hola,anoche me paso lo mismo prendio en el tablero primero el abs luego el de control de traccion y luego se apagaron el tablero estereo y el motor no tiene ni 20000 km mi eco es 2015 tan rapido se agoto mi bateria''
hace 3 meses
Mejor solución  (según Juan Carlos, el autor del problema) 
Martín, el caso de tu vehículo puede ser fortuito, seria bueno que lo consultaras en el servicio técnico por la diferencia de kilómetros, el mio ya tiene 72000 km., pero el vehículo arrojo lo mismo de lo que acabas de describir, ya le hice el cambio de batería y a la fecha no ha presentado problemas.
hace 3 meses
Mejor solución  (según Juan Carlos, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · motor 1.6 duratec · 130000 kms
Apreto embrague y freno ,a veces arranca y aveces no,cuando arranca sale en pantalla MOTOR AVERIADO y el acelerador no va mas de 80 km/h y a veces no acelera...Los dos problemas aparecieron juntos. Lo lleve a 5 talleres y no me lo solucionaron y en las concesionarias Ford no me la quieren recibir porque tiene GNC
OM
omar nicolasArgentina
hace 3 meses
y otras 10 personas con el mismo problema
Respuestas de la comunidad
En este momento está en un taller y todavía no me lo pueden arreglar ,ante cualquier novedad les comunicó y si alguien sabe algo sobre este problema avisenme por favor.
hace 3 meses
Mejor solución  (según omar nicolas, el autor del problema) 
Revisen los filtros de la bomba, porque es escáner no detecta esa falla
hace 2 meses
Mejor solución  (según omar nicolas, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 5 puertas 1.6 zetec rocam  · 2164 kms
Empezo por prender levemente una luz que se veia en el cuenta quilometros entre la marca de 80 y 100 KMS.. . Luego al apagarla se enloquecia el tablero ,quedaba prendido y se movian las agujas(no siempre las mismas) le cambie bateria y solucione en parte porque la luz leve del cta kilometros seguia titilando. Hoy por un rato tuve de vuelta el problema completo que relate y se normalizo SOLO.LA camioneta anda bien. Solo que al estar apagada apartecen esos problemas. Selmar.
SE
SELMAR Uruguay
hace 3 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Revisa el cable de masa (-) del polo negativo a chassis, a motor, a baes de la computadora, a tablero, pueden estar sueltos, sulfatados, con aceite ETC.
hace 3 meses
Mejor solución  (según SELMAR , el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 200000 kms
Sube la temperatura del motor y no enciende el motoventilador , ya revise fusibles y están en buenas condiciones , cambie los relevadores y desconecte el sensor y no encendió st
AR
arturoMéxico
hace 3 meses
y otras 5 personas con el mismo problema
Respuestas de la comunidad
-1
El ventilador debe estar defectuoso, conectalo directo a la bateria para comprobarlo
hace 3 meses
arturoSolucionado , el problema era los conectores del ventilador tenía un falso contacto , sustituí el conector y asunto arreglado.
hace 3 meses
Mejor solución  (según arturo, el autor del problema) 
Mejor solución  (según arturo, el autor del problema) 


¿Problemas con un Ecosport? Compártelos
Enviar comentario  Cancelar
Enviar respuesta  Cancelar
Cargando...

¿Encontraste lo que buscabas?

¡GRACIAS!

Cargando...