Problemas de Motor del Ford Ecosport




Problemas por categoría

Solucionado
 Ford Ecosport  2007 · 4 puertas 2.0 Duratec 4x2 sincronico  · 167000 kms
Tengo problemas con mi Ecosport Año 2007 sincrónica 2.0 Duratec, cuando la enciendo en las mañanas se me ahoga y si prendo el Aire Acondicionado mas todavía y tengo que a pagarlo y cuando tiene rato prendida y rodando se me desmaya, que podrá ser, el catalizador, el sensor Map o la capsula pcv,, alguna sugerencia... ay veces cuando ando en carretera y al parar tiende a pagarse y tengo que acelerarla, cuando meto velocidades tengo q acelerar para q agarre fuerza... que podría ser... Solución. Otra cosa: la tengo con los servicios al dia. Le cambie la bomba de gasolina, filtro de gasolina de aire y de aceite, servicios de inyectores, cuerpo de aceleracion, IAC, TPS, cambio de aceite, bujias, cable de bujias todo al dia y sigue fallando
AL
Alberto AndradeVenezuela
hace un día
y otra persona con el mismo problema
Respuestas de la comunidad
Revisa el sensor de temperatura ETC del refrigerante , si manda una señal erronea a la computadora ocasiona esas falla. Ya se le cambio el anticongelante ? se debe de cambiar cada 40,000 km. o 2 años de uso.
hace 16 horas
Alberto AndradeBuenas Noches Ricardo, nada de eso es, ya que tiene todos sus servicios recientes, y solo me falta chequear la capsula PCV que al parecer este tapada, y no me arroja ningun tipo de señal erronea en el tablero, deberia de aparecer la luz amarilla, pero nada de eso aparece... hice encuesta a varios mecanicos y me informaron que es la capsula PCV que pueda que este tapada, el catalizador no me arroja ninguna señal erronea... y estoy optando por esa capsula y sensor MAP, alguna otra sugerencia... Gracias
hace 7 horas
Mejor solución  (según Alberto Andrade, el autor del problema) 
Mejor solución  (según Alberto Andrade, el autor del problema) 
Esas mismas fallas la ocacionaba mi camioneta y descubri q eran las lunes antinieblas puede hacer la prueba cuando valla en la via pendala y le ocacionara esa falla luego apaguelas y vera como empareja y eso se debe a la bobina cuando no es original
hace 8 horas
Alberto AndradeSaludos Jose, ya hice la prueba y nada de eso es... la falla continua, voy a cambiar la capsula PCV y hacerle servicios a todo para descartar, gracias por su sugerencia, alguna otra sugerencia, de antemano...
hace 7 horas
Mejor solución  (según Alberto Andrade, el autor del problema) 
Mejor solución  (según Alberto Andrade, el autor del problema) 

Solucionado
 Ford Ecosport  2007 · modelo xlt · 141000 kms
Al estar frio el vehiculo y encenderlo funciona bien, luego de unos 20 minutos de estar encendido y ya haberse calentado empieza asentirse unos sacudones en el motor, por la esperiencia que uno tiene inmediatamente pense que era salto de corriente en los cables, estos sacudones se hacen cada ves mas seguidos que cuando viro la direccion aveces se me apaga el vehiculo, lo vuelvo aprender y enciende sin problemas, me he puesto a observar el motor en la oscuridad y no veo salto de chispa por ningun lado, pero me pongo a pensar de ser los cables la falla deberia manifestarse al prendel el vehiculo aun en frio, quisiera leer sus opiniones o comentarios para tratar de solucionar, bien recibidos seran, gracias de antemano.
MO
Moises Simon Piñate FerrerVenezuela
hace 2 días
y otra persona con el mismo problema
Respuestas de la comunidad
Revisa si esta completo el nivel de aceite de la direccion hidraulica o si presenta algun ruido la bomba de la direccion hidraulica.
hace 2 días
Mejor solución  (según Moises Simon Piñate Ferrer, el autor del problema) 
Buena tarde, tengo un problema similar, mi ecosport 2007 en frío trabaja perfectamente, pero después de media hra de manejar en carretera, y tengo q frenar x alguna razón o bajar la velocidad y hacer el cambio de velocidad empieza a jalonearse, como si brincara la corriente o dejara de inyectar combustible, y permanece el fallo, lo q tengo q hacer es acelerar a fondo con el clutch adentro, y si no se le quita es apagarla y encenderla de nuevo y vuelve a su normalidad, pero luego vuelve hacer lo mismo, alguien me podría orientar de esto?
hace 2 días
Mejor solución  (según Moises Simon Piñate Ferrer, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · 5 puertas, motor 1.6 · 48000 kms
Hoy, 28/09/16, al dar contacto para arrancar el motor la luz amarilla de motor se quedo encendida, no percibo falla, me detengo con el motor en marcha y la luz parpadea, continuo la marcha y la luz sigue encendida permanentemente. Les agradeceria si me pueden ayudar. Desde ya muchas gracias.
FE
FernandoArgentina
hace 2 días
Respuestas de la comunidad
Modo de Autocomprobación, para pasar al modo de autocomprobación del cuadro de instrumento haga lo siguiente:

1. Pulse y mantenga pulsado el botón de puesta a cero del cuentakilómetros parcial (RESET) y, a continuación, ponga el contacto en la posición II ó III.
2. Suelte el botón de puesta a cero del cuentakilómetros parcial cuando aparezca TEST en la pantalla de cristal líquido (LCD). Esto tarda entre cinco y ocho segundos. 3. El cuadro de instrumentos realiza la prueba de potenciómetro del indicador.4. Para pasar a las siguientes pruebas mientas se está en el modo de autocomprobación, pulse el botón de puesta a cero (RESET).5. La autocomprobación se desactiva cuando se desconecta el contacto (OFF). Un consejo: Cuando leas la palabra DTC en la pantalla, debe poner NONE, si pone algun numero es q hay algun tipo de error.
hace 2 días
Mejor solución  (según Fernando, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 4x4 motor 2.0 · 140000 kms
Tengo dudas sobre si la falla es la valvula iac o la tps
OR
OrangelVenezuela
hace 3 días
y otra persona con el mismo problema
Respuestas de la comunidad
Le saque la valvula iac y la limpie con un limpiador de carburadores pero la falla continua que debo hacer como reconocer si la valvula iac estaq dañada?
hace 3 días
Mejor solución  (según Orangel, el autor del problema) 
Desmonta la iac , conecta la llave en on (sin encender ) se debe mover el eje de la valvula central
hace 2 días
Mejor solución  (según Orangel, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 4x4 motor 2.0 · 140000 kms
Tengo dudas sobre la valvula iac o la tps
OR
OrangelVenezuela
hace 3 días
y otra persona con el mismo problema
Respuestas de la comunidad
La mia se acelera hasta 3000 revoluciones cuando cuando estoy en un semaforo o en una cola, me comentan que es la valvula iac otro amigo la escaneo y dice que los valores del sensor tps es muy alto que esta dañado, ambos repuestos son costosos como puedo comprobar si efectivamente es el sensor tps o la valvula iac?
hace 3 días
Mejor solución  (según Orangel, el autor del problema) 

Solucionado
 Ford Ecosport  2006 · 4puertas · 150000 kms
Saludos amigos, me veo en la necesidad de entrar acá por que tengo una ecosport 2.0 2006 sincrónica, la falla que tiene es que me da una pequeña explosión en el cuerpo de aceleración, la camioneta en frió no me hace falla alguna pero luego de calentar para arrancar se ahoga y luego de marchar esta bien... por ello se le cambio la bomba de gasolina completa original... limpieza de inyectores, cambio de bobina, cambio de cables, sensor tps, anille el motor, mande hacerle asentamientos de válvulas y la falla persiste... cambie una manguera de aire que esta debajo del cuerpo de aceleración que estaba algo obstruida y sigue... dos veces se a escaneado y no arroja fallas no se quien puede ayudarme... sera que tengo que ir a una iglesia con ella? agradecería la ayuda... saludos a todos.
JD
jdiazVenezuela
hace 4 días
y otras 6 personas con el mismo problema
Respuestas de la comunidad
Revisa el sensor MAP puede estar sucio o defectuoso
hace 4 días
Mejor solución  (según jdiaz, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 187000 kms
Hola q tal gente m pueden ayudar resulta q tngo una ecosport 07 resulta q hace unos dias el electro se prendia a cada rato y al ultimo lo hacia apenas ponia la marcha cuando revise se corto la ficha dl sensor d temperatura como era sabado lp deje asi para cambiarlo el lunes lo q si quedo acelerado siempre en punto neutro quedaba a menos d mil revoluciones ahora pasa las 1100 aproximadamente y lo peor es q ahora no quiere prende el arranque la lleva pero no enciende el motor q el sensor no este conectado tiene q ver en eso ademas m falla el centralizado
MI
misaelArgentina
hace 4 días
y otra persona con el mismo problema
Respuestas de la comunidad
Mientras NO reciba señal de temperatura la computadora NO da arranque , cuando se cambie el conector del sensor de temperatura encendera nuevamente
hace 4 días
Mejor solución  (según misael, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 5 puerta · 13522 kms
Me está mesclando,y la temperatura es muy alta en un tiempo muy corto
NO
norbertoRepública Dominicana
hace 4 días
y otra persona con el mismo problema
Respuestas de la comunidad
La culata es la que esta en medio del monoblock y la tapa de punterias.
hace 4 días
Mejor solución  (según norberto, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · 4 · 50000 kms
Hola, soy nuevo aqui... les presento mi problema espero me ayuden a solucionarlo.
Tengo una Eco Freestyle 2013 con 50milkm, acabo de cambiarle la bomba de agua, es la 1era vez que le hago algo. Una vez cambiada me surge el siguiente problema. - no regula bien, presenta falla al andar
Para solucionar esto me han:
- cambiado las bujias
-filtro de aire
-coloque limpia inyectores
- scaneado y reseteado la computadora, esto no arrojo ningun problema y todos los valores estan normales... pero sigo notando una pequeña falla al regular... ejemplo estar parado en un semáforo. QUE PUEDE SER?? Ya no se mas que hacer y no quiero seguir gastando dinero sin solucionar este problema. Me pueden ayudar?
MA
mandrasArgentina
hace 4 días
Respuestas de la comunidad
Desconecta el sensor de oxigeno , si mejora lo cambias.
hace 4 días
mandrasGracias por tu respuesta! ahora se puede utilizar el auto con este sensor desconectado? no provoca ningun problema, alerta en el tablero o algo q detecte la computadora?
hace 4 días
Mejor solución  (según mandras, el autor del problema) 
mandrasAl scanearlo no aparece el mensaje de error P0133 SENSOR OXYGEN NO ACTIVITY... es mas da todo normal
hace 4 días
Mejor solución  (según mandras, el autor del problema) 
Mejor solución  (según mandras, el autor del problema) 

Solucionado
 Ford Ecosport  2006 · 125000 kms
Le cambie las manguera de calefacción desde entonces trabaja normal por unas oras y de repente
Sube arriba de lamiad y no se calentaba antes del cambio
SA
samuelMéxico
hace 7 días
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Le quedo aire al sistema de enfriamiento ,hay que purgarlo bien
hace 6 días
Mejor solución  (según samuel, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 5 puertas · 175000 kms
Le cambie casi todo me refiero a :revisión de tapa cilindro,cambie pieza completa de termostato,bomba de agua,deposito de agua y tapa nueva y revisión del radiador todo vien y sigo con problema de que se sube la temperatura que mas hago...
PE
Pelr.Chile
hace 9 días
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Es un defecto de diseño de fabrica de FORD , hay que cambiarle la polea de la bomba de agua a una mas chica para que tenga mas rpm y recircule mas eficientemente el anticongelante.
hace 9 días
Mejor solución  (según Pelr., el autor del problema) 
Luis Sanchez
Gracias ya solucione el problema con la polea, saludos a todos.
Responder
Hace 3 meses
hace 9 días
Mejor solución  (según Pelr., el autor del problema) 
Estimados: quisiera su ayuda y recomendación de un mecánico para mi eco, no se donde llevarla con confianza si ustedes me pueden dar un dato se los agradecería, la eco la compre usada es el primer vehículo que tengo como referencia es del año 2005, motor 1.6, y tiene 103.000 km y hoy al llegar a mi destino pare el motor y note que el refrigerante del deposito del radiador estaba hirviendo, en ningún momento sobre la marcha me mostro un mensaje o algo en el panel y el termómetro del mismo panel se mantuvo en el medio normal, nunca indico un aumento de temperatura, la deje enfriar pero no se que mas hacerle y no se tampoco donde llevarla aun no tengo un mecánico. :( que hago...
hace 8 días
Mejor solución  (según Pelr., el autor del problema) 
Si no subio temperatura, es la tapa del radiador que no sella , fuga presion y anticongelante al deposito de retorno, consiguela de las mismas libras de presion de la original
hace 8 días
Mejor solución  (según Pelr., el autor del problema) 
Solucionado
 Ford Ecosport  2010 · 133 kms
Puede ser q se apaga el motor o no regula q sea la bobina
TI
tinchoArgentina
hace 11 días
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Revisa la valvula iac (valvula de aceleracion minima) esta oculta detras del multiple, puede estar sucia ,se lava con limpiador w 40 , si no mejora hay que cambiarla por otra original.
hace 11 días
FabianHola necesito ayuudaaaa urgente necesito saber que sera porque no le cargue nafta tengo una ford ecosport y ahora no arranca mas y no se que sera me podrian ayudaar urgenteeee
hace 5 días
Mejor solución  (según tincho, el autor del problema) 
Mejor solución  (según tincho, el autor del problema) 
Al conectar la llave en ON (sin encender ) se escucha el zumbido de la bomba de gasolina ? si no se escucha revisa le fusible y el reele de la bomba de gasolina que esta en la caja de fusibles en el motor, en la tapa esta la ubicacion y servicio.
hace 3 días
Mejor solución  (según tincho, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · TDCI · 121000 kms
Buenss tardes. Les comento que hace unos meses en mi ecosport tdci 2004. Se paso el aceite al agua. Como primer medida se cambio el radiador de aceite, y el problema continuó. Lo lleve a otro mecanico y se le hizo la tapa, y se limpio todo el circuito. A los dias, en una subida no muy pronunciada calento mucho quemando el protector de alfombra que tiene el motor por detras del radiador, al abrir el deposito de agua notamos que no tenia agua. Por lo que le agregamos y continuamos camino sin dificultad. Al dia siguiente se lo vuelvo a llevar al mecanico y en ese trayecto le senti mucho olor a di…Leer completa
FE
FernandoArgentina
hace 11 días
y otra persona con el mismo problema
Respuestas de la comunidad
Saliendo del mecanico, a pie por supuesto. Paso a describir:
No es aceite al agua, ni agua al motor, pero no se sabe donde va a parar el agua del deposito. Tampoco sale agua por el caño de escape.
Una de las mangueras que lleva el agua esta fria. La otra caliente, y retorna el agua con ollin, no es aceite de motor. Las manchas debajo de la canioneta es diesel. Por otro lado hay un cable que conecta la bateria con los fusibles que se calienta bastante. El motor en funcionamiento viene parejo y cada tanto quiere hacer como un corte. Katrina de chanes. La eco TDCI es el peor auto que jamas tuve, pero a seguir remando.
hace 10 días
Mejor solución  (según Fernando, el autor del problema) 
Hola ami me paso algoo mas o menos iguall mi camioneta le hice la afinacion antes de salir de viaje y ya de regreso me marcaba que no tenia aceite en un trayecto de 321 kilometros mas o menos tuve que echarle 7 litros de aceite y me la checaron y me comentan que no la tira solo la quemaa.
hace 9 días
Mejor solución  (según Fernando, el autor del problema) 
Buenas tardes
Tengo una eco 2004, le acaban de hacer la afinacion, pero un detalle trae un olor tipo gasolina o aceite quemado, eso pasa cuando la usa todo el dia,
Tambien en la mañana la prendo para que se caliente y humea ya despues de 10 min ya no solamente en la mañana me puedes ayudar
hace 8 días
Mejor solución  (según Fernando, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 4 puertas estándar electrica · 150000 kms
Buenos días tengo un problema con mi eco los síntomas son, la enciendo por las mañanas y enciendo bien pero a los 3 minutos empieza un corcoveó del motor como tirando a apagrase de ves en cuando se apaga y cuando la acelero se escucha un ruido de tuc tuc cerca del filtro de aire me dicen q puede ser la iac, ya la limpie tambien se lavo el cuerpo de aceleración y cuando pasa todo esto la aguja de las rpm osila en lo minimo osea sube y baja pero en lo minimo despues le doy un acelern y regresa a la normalidad pero al ratito otra vez, otro es q cuando quiero salir de golpe o rebasar no hay potencia,
OS
OscaritoMéxico
hace 11 días
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Estoy presentando el mismo problema y es que cuando se destabiliza el motor en minimo es porque deja de funcionar un cilindro en micaso es el 3 y suena asi mismo como dices tac tac tac y cuando acelero se le quita tambien se apagaba en minimo y le cambie la bujia y ya no se apaga e llegado a pensar que cuandofalla es porque cae agua de la empacadura al cilindro y moja la bujia ya que al acelerarlo no falla solo falla en minimo y en algunas ocasiones cuando necesito arrancar rapido
hace 10 días
Mejor solución  (según Oscarito, el autor del problema) 
Revisa las bujias del motor el sonido y la falla que estas presentando cuando se desestabiliza en minimo es porque deja de funcionar un cilindro
hace 10 días
Mejor solución  (según Oscarito, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 2.0 4x2 · 145690 kms
Hola amigos tras la armada reciente del motor después de ser anillado mi ecosport no tiene fuerza el primer cilindro no funciona y al llegar a 3000 revoluciones pareciera que tengo una matraca tracacacacacacacacacacacacacacacacaacacacacacacacacacacaca alguien que me de su opinion por favor...de paso el mecánico se convirtió en mago... desapareció el desgraciado...
IR
irwingVenezuela
hace 11 días
Respuestas de la comunidad
Valvulas de la tapa de compresion enciende el motor y trata de tapar con un carton el escape si succiona el carton tienes problemas con las valvulas
hace 10 días
Mejor solución  (según irwing, el autor del problema) 
Sin mucho probar el problema alli son valvulas dobladas
hace 5 días
Mejor solución  (según irwing, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 160 kms
Tengo una ford ecosport... cuando la revolucion llega a 4.5 vuelta el motor corta y no deja revolucionar mas y corcovea, ademas el contador de velocidades no marca, queda en cero... me dijeron que puede ser el sensor de velocidad...

Alguien que me de su comentario de lo que pueda estar sucediendo...

Grac
RE
renneVenezuela
hace 12 días
Respuestas de la comunidad
Revisa el sensor de velocidad y el arnes de conexión ,esta en la transmision. Mientras no marque el velocimetro no funcionara normal.
hace 12 días
Mejor solución  (según renne, el autor del problema) 
Podrias estar presentando problema con el tps desconecta el conector y prueba si se elimina la falla replaza el tps esta ubicado debajo de donde llega la gualla de acelerador
hace 10 días
Mejor solución  (según renne, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · 85000 kms
Hola amigos mi Eco siempre anduvo bien pero hace unos días se empezó a prender la luz amarilla y el motor empieza a no tirar nada especialmete si voy a baja velocidad y comienza a fallar el modulador de aceleracion
CA
CarollArgentina
hace 13 días
y otras 10 personas con el mismo problema
Respuestas de la comunidad
Si es la bateria que trajo de fabrica , debe ser que ya requiere cambiarse. Antes que ya no funcione nada.
hace 13 días
Mejor solución  (según Caroll, el autor del problema) 
Hola a todos, gracias por las sugerencias, hice revisar la batería y también le puse líquido de limpieza de inyectores pero pese a ello la luz sigue titilando en algunas ocasiones. Si logro solucionar el problema lo daré a conocer.
hace 3 días
Mejor solución  (según Caroll, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 180000 kms
Hola buenas noches soy nuevo acá... quería comentar un problema que estoy teniendo con mi ecosport el cual ya tiene tiempo así el problema es que taquetea mucho al prenderla al acelerar siempre suena... muchos me dicen que es la cadena de tiempo otros que los taquetes en realidad quisiera que me ayudaran para tener una certeza de lo que será para no hacer un gasto en vano...
AL
alanVenezuela
hace 14 días
y otra persona con el mismo problema
Respuestas de la comunidad
Si le estas poniendo aceite 15w 40 esa es la causa. Ya que lleva aceite 5w 30 si hay clima templado y 5w 40 si es calido.
hace 13 días
Mejor solución  (según alan, el autor del problema) 
El problema que presenta tu vehiculo es que no esta en el tiempo se movio el tiempo o alguna vez cambiaron la estopera del motor y no lo pusieron a tiempo si este motor si es duratec 2.0 no utiliza taquetes utiliza puentes de valvula completamente mecanico tambien podria ser que la cadena este estirada y haya que graduar el tensor de la cadena ese motor trabaja perfectamente con 15w40
hace 13 días
Mejor solución  (según alan, el autor del problema) 
Solucionado
 Ford Ecosport  2009 · XLS 1.6 · 98000 kms
Hola, tengo una Ecosport 2009 de 0 km con 98000 km y recién mi primer problema, resulta que dejó de funcionar el velocímetro y el odometro quedo con rallitas, así dos dias hasta que me apareció marcado el indicador de un motor,compre un sensor de velocidad nuevo marca valeo ($750) y lo lleve al mecánico que le hizo un escaneo ($1200), el motorcito se soluciono , pero sigo sin velocímetro ni odometro , y el escaneo da que el tablero está bien, y el conector del sensor tiene corriente, ya no sé qué hacer, gracias
AL
AlfredoArgentina
hace 14 días
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Tiene que ser sensor original , el generico no lo reconoce la computadora.
hace 14 días
Mejor solución  (según Alfredo, el autor del problema) 
Hola tengo una ecospot 2010 y el cuenta vuelta me dejo de funcionar de por rato si y de por rato anda no se que le pasa y no me marca los kilometros cuando de de funcionar y el cierre centralizado tarda en cerrar las puertas en movimiento
hace 2 días
Mejor solución  (según Alfredo, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 2.0 xlt full · 200000 kms
Prende la luz del check a nafta o gas, y luego se pone en tres cilindros, tiene buena compresión el motor, pareciera algo eléctrico pero el sanear no larga ninguna falla...pero falla
JA
JAF71Argentina
hace 15 días
y otra persona con el mismo problema
Respuestas de la comunidad
Se corrige sola, dura poco hasta una pendiente leve, repite el cuadro...la paro y arranca bien en cuatro cilindros
hace 15 días
ricardoEn el 2011 empezaron a usarlas en el fiesta y focus ,ya la estan montando en todas sus unidades a pesar de presentar multiples fallas y defectos. La transmisión Powershift de Ford es la apuesta de la marca para bajar tanto el consumo de combustible y la emisión de gases contaminantes en sus autos nuevos, más específicamente en los modelos Fiesta y Focus de nueva generación. Esta caja automática robotizada, utiliza la tecnología de doble embrague –o clutch- que también utilizan otras marcas, sólo que ésta es más compacta y ofrece algunas otras ventajas que detallaremos más adelante.
¿Cómo funciona?
Esta parte puede ser un poco tediosa, pero trataremos de hacerlo de la manera más amena posible para describir su funcionamiento. Todas las transmisiones modernas –automáticas o manuales- cuentan con dos trenes de engranes, uno para las velocidades pares (2ª, 4ª y 6ª) y otro para las nones (1ª, 3ª y 5ª). Estos trenes reciben el torque del motor mediante el disco del volante inercial (que a la vez está conectado al cigüeñal que a su vez recibe el impulso de los pistones) pero para cambiar entre un tren y otro, el embrague separa momentáneamente un tren para engranar el otro. Esta tarea se puede realizar mecánicamente (transmisiones manuales), hidráulicamente (transmisiones automáticas convencionales) o eléctricamente (transmisiones robotizadas) pero al contar con un solo clutch o embrague, la tarea es más lenta. Aquí es donde las transmisiones de doble embrague entran en acción pues al tener un embrague para cada uno de los trenes se pueden separar las tareas de desacoplamiento y acoplamiento para cada uno de ellos, logrando que los cambios sean prácticamente instantáneos. La forma en que lo hace es la siguiente: suponiendo que el auto arranca en primera velocidad, el usuario acelera hasta que el motor llega a un determinado número de rpm (dependiendo de la situación y cuánto está presionando el conductor el pedal del acelerador, pueden ser más o menos revoluciones por minuto del motor), entonces la computadora manda la señal a los motores eléctricos de la transmisión Powershift y al mismo tiempo que el clutch para las velocidades nones (1ª, 3ª y 5ª) desacopla el tren de éstas, el otro embrague acopla el tren de las velocidades pares (2ª, 4ª y 6ª). Todo esto sucede en fracciones de segundo así que el motor prácticamente se mantiene en la misma curva de torque y no tiene que volver a empezar desde abajo para recuperar el impulso. Esto se traduce en un mejor aprovechamiento de la energía del motor, un menor consumo de combustible y menor producción de gases contaminantes.
Otras ventajas de esta transmisión son las siguientes:
-Gracias al diseño compacto y a la falta de sistema hidráulico, la Powershift ahorra 70 kg en el peso total del auto (menos componentes y menos fluidos). -La caja es más compacta gracias a los actuadores electromecánicos que sustituyen a los hidráulicos para mover los trenes de velocidades, esto le permite ocupar menos espacio bajo el cofre y acomodar más fácilmente los demás componentes del motor. -La transmisión viene sellada de fábrica, gracias a que el único fluido que contiene es el que lubrica la parte interna, además los actuadores que mueven los trenes de velocidades son eléctricos convirtiéndola en una transmisión libre de mantenimiento por hasta 10 años. -Gracias a que los embragues son controlados por una computadora y no por un humano, la vida de las pastas se prolonga mucho más, así que el clutch se cambia cada 10 años en un escenario óptimo.
Como todo, también existe un lado negativo o por lo menos algunos detalles que se podrían traducir por el usuario como fallas o comportamientos extraños. Éstos son algunos de ellos y sus causas:
-Al ser una transmisión manual robotizada, Powershift no cuenta con fluido hidráulico para su funcionamiento, sólo el aceite que lubrica internamente, entonces los ruidos que se producen al acoplar y desacoplar las velocidades se hacen más evidentes. En una transmisión automática convencional, el fluido y el mismo sistema aíslan estos ruidos. -Al apagar el motor, la transmisión tiene que prepararse para cuando el auto se vuelva a encender, así que en algunas ocasiones se pueden escuchar ruidos de la transmisión aunque el motor se haya apagado. No es ninguna falla, sino que la Powershift se está moviendo internamente para quedar en una posición ideal para el arranque. -Como su accionamiento es más parecido al de una transmisión manual que al de una automática convencional, la Powershift de Ford puede provocar que el auto se mueva hacia atrás cuando el freno no se aplicó y el sistema de ayuda en pendientes no frenó el auto, tal como lo pasaría con una caja manual. Es cuestión de acostumbrarse pues bajo ninguna circunstancia el auto avanzaría mucho, antes el sistema entra en acción y engrana la primera velocidad o la reversa según sea el caso.
Ford está continuamente trabajando para mejorar el funcionamiento de la Powershift y aislar los ruidos que se producen durante los cambios o los raros casos en los que se llega a calentar el sistema. Aproximadamente, dos o tres veces al año se realizan ajustes en la programación de la computadora de la transmisión y cada que el usuario lleva su auto a la agencia para servicio, se actualiza el software de la transmisión a la versión más reciente. Son defectos de diseño de transmisiones de fabrica de ford. Que no termina de perfeccionar, por lo que aumento a 10 años de garantia. Llevalo al distribuido ford
hace 14 días
Mejor solución  (según JAF71, el autor del problema) 
Mejor solución  (según JAF71, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · 150000 kms
De pronto un ruido fuerte de chillido de correa, le cambio la polea y el tensor el ruido sigue y el mecanico dice que debo ponerle una polea de media pulgada mas o colocarle una correa una pulgada menos...pero todo sigue igual con el chillido.
DO
DORYSVenezuela
hace 15 días
Respuestas de la comunidad
Revisa la polea del alternador , hay unas que traen un embrague y cuando se rompe puede frenarse y ocasionar el chillido
hace 14 días
Mejor solución  (según DORYS, el autor del problema) 
Amigo yo reparo alternadores y estoy totalmente seguro que son las rolineras del alternador... ya están malas y se trancan al momento de girar a por consiguiente para la polea y al deslizar la corea suena ese chillido
hace 14 días
Mejor solución  (según DORYS, el autor del problema) 
Ya se revisaron las poleas y nada alguien me dice que pueden ser los soportes del motor...esto me tiene en la locura
hace 13 días
Mejor solución  (según DORYS, el autor del problema) 
Con el motor funcionando hechales agua a la correas , si se calla son las bandas que estan gastadas o sueltas.
hace 13 días
Mejor solución  (según DORYS, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 95850 kms
Sube la temperatura a mas de la mitad el motoventilador empieza a funcionar después de que la temperatura esta ala mitad ya le cambie el sensor de temperatura
GO
GonzalezMéxico
hace 16 días
Respuestas de la comunidad
La ecosport trabaja siempre con la temperatura a la mitad revisa los relays que controlan el electro, estan abajo directamente bajo el electroventilador
hace 15 días
Mejor solución  (según Gonzalez, el autor del problema) 
Debes verificar que este trabajando la velocidad baja del electro enciende el vehiculo y desconecta el sensor de temperatura y observa que encienda la velocidad baja y luego de 3 segundos encienda la velocidad alta si no esta encendiendo la velocidad baja de tu electro ese es el problema este vehiculo utiliza 2 relay uno para la velocidad baja del electro y otro para la velocidad alta del electro estan ubicados en lado izquierdo del mismo lado que la bateria al lado de la cajera del radiador parte inferior
hace 13 días
Mejor solución  (según Gonzalez, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · titanium 2.0 · 56000 kms
Hola, lleve la eco al service de 60mil para cambiar las bujías y me dicen q la #1 esta trabada, q si le hacen fuerza se puede romper y si sucede esto deben sacar la tapa de cilindro y cambiar juntas, etc. El tema es q los mismos del concesionario me dicen q es una falla de fábrica del motor 2.0, q ya les paso y no saben a q se debe, puede ser agua en el cilindro de la bujía y x eso se "agarra" no la pueden sacar para el cambio. Es realmente cierto, alguien tuvo algo similar, lo cubre la garantía.
EC
Eco2013Argentina
hace 16 días
Respuestas de la comunidad
Los ford estan trayendo muchos defectos de fabricacion , mas los modelos TITANIUM
hace 14 días
Mejor solución  (según Eco2013, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · motor 1.6 duratec · 130000 kms
Apreto embrague y freno ,a veces arranca y aveces no,cuando arranca sale en pantalla MOTOR AVERIADO y el acelerador no va mas de 80 km/h y a veces no acelera...Los dos problemas aparecieron juntos. Lo lleve a 5 talleres y no me lo solucionaron y en las concesionarias Ford no me la quieren recibir porque tiene GNC
OM
omar nicolasArgentina
hace 17 días
y otras 8 personas con el mismo problema
Respuestas de la comunidad
En este momento está en un taller y todavía no me lo pueden arreglar ,ante cualquier novedad les comunicó y si alguien sabe algo sobre este problema avisenme por favor.
hace 9 días
Mejor solución  (según omar nicolas, el autor del problema) 
Revisen los filtros de la bomba, porque es escáner no detecta esa falla
hace 2 días
Mejor solución  (según omar nicolas, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 200000 kms
Sube la temperatura del motor y no enciende el motoventilador , ya revise fusibles y están en buenas condiciones , cambie los relevadores y desconecte el sensor y no encendió st
AR
arturoMéxico
hace 17 días
y otras 4 personas con el mismo problema
Respuestas de la comunidad
-1
El ventilador debe estar defectuoso, conectalo directo a la bateria para comprobarlo
hace 17 días
arturoSolucionado , el problema era los conectores del ventilador tenía un falso contacto , sustituí el conector y asunto arreglado.
hace 17 días
Mejor solución  (según arturo, el autor del problema) 
Mejor solución  (según arturo, el autor del problema) 
Solucionado
 Ford Ecosport  2015 · 15000 kms
HOLA AMIGOS DE CHAT, tengo una ECOSPORT año 2015 con 15.000 KM y casi todas las veces que voy a encender el motor suena una alarma sonara después de arrancar se apagan todos las luces del tablero y la alarma desaparece. Fui varias veces al concesionario y sin ninguna respuesta satisfactoria. Alguien tiene es problema o tuvo solución del mismo Gracias
MA
MartiArgentina
hace 18 días
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2010 · 4x2 · 48500 kms
Lo lleve a scannear y me dijeron q' era el sensor de arbol de levas,,se lo compre,y sigue igual con la siguiente descripción, P0340,mal funcionamiento del circuito A, del posicionamiento de arbol de levas,,,quiero mencionar q' no tengo ningûn problema en cuanto a potencia y encendido,,solo es la molestia del check engeen hasta el momento¿Q' debo hacer,ya q' el electrico me cobra una fortuna? Gracias
JA
JavierMéxico
hace 18 días
Respuestas de la comunidad
P0340 FORD - Posición del árbol de levas Banco Circuito Sensor 1 Sensor 1 Compartir 8 | Añadir comentario Posibles causas - Árbol de levas defectuoso del sensor de posición - arnés del sensor de posición del árbol de levas está abierto o en corto - circuito del sensor de posición del árbol de levas mala conexión eléctrica - Defecto del motor de arranque - A partir del circuito del sistema - Dead batería (Débil)

Read more: http://www.autocodes.com/p0340_ford.html
Solo falto resetearla: desconecta el polo negativo de la bateria x 5 min. Y vuelve a conectar firmemente.
hace 17 días
Mejor solución  (según Javier, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 4 puertas,base ,motor naftero · 170000 kms
Hola , tengo una ecosport , y se me recalienta del deposito al motor de agua ! No circula al radiador , se mantiene frio y no calienta. Le saque el termostato para provarlo y sigue igual. Alguna solucion??
NI
NicolasArgentina
hace 19 días
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Esta tapada la manguera delgada que llega al deposito, hay que destupirla bien o cambiarla.
hace 19 días
Mejor solución  (según Nicolas, el autor del problema) 
En la manguerita que llega al deposito de agua usa una valvulita interna a veces se obtruye cuando el vihiculo este frio sopla en sentido al motor para saber que este libre
hace 13 días
Mejor solución  (según Nicolas, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · 188000 kms
Estoy usando aceite 15/40 semisintetico. Esta consumiendose no se ve ningun bote ni rastro. Deberia cambiar de aceite ? La camioneta tiene 188.000 km.
LU
LuisVenezuela
hace 20 días
y otra persona con el mismo problema
Respuestas de la comunidad
Ese aceite es inadecuado , al haber mala lubricacion se calienta y consume. Ese motor lleva aceite multigrado segun ford 5w 30 en clima templado y 5w 40 en clima calido, no importando el kilometraje.
hace 19 días
Mejor solución  (según Luis, el autor del problema) 
El aceite que utilizan de fabrica es el 5w30 y 10w30 pero el que estas utilizando aplica debido al kilometraje que tienes si no es mucho el consumo puede ser la marca de aceite que estas utilizando o las gomitas de valvula verifica si humea cuando enciendas en frio en la mañana
hace 13 días
Mejor solución  (según Luis, el autor del problema) 
Solucionado
 Ford Ecosport  2009 · 2.0 standar · 225000 kms
Buenas tengo la falla con una Ecosport 2009 2 litros se le empezó a perder potencia luego la lleva el mecánico Me comentaron que tenía el catalizador tapado le han hecho pruebas y sigue prendiendo el check in me indican que es el sensor del árbol de levas ya se le cambió dos veces y la falla continúa se le checaron el cableado la computadora y Sigue perdiendo potencia y echando explosiones de repente quema las bujías las llega a tronar la llevara con varios mecánicos Y ninguno da lo que es ya le checaron la compresión servicio en servicios el mantenimiento en general y la falla No se le quita a veces disminuye solamente les agradezco sus respuestas y su ayuda
ED
EduardoMéxico
hace 21 días
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Desconecta el sensor de oxigeno, si mejora lo cambias
hace 21 días
Miguel D.Buen día, te comento me paso lo mismo hace unos días, poseo una Ecosport modelo 2004 2.0, resulto ser el Sensor MAP, este fue sustituido y problema resuelto.
hace 4 días
Mejor solución  (según Eduardo, el autor del problema) 
Mejor solución  (según Eduardo, el autor del problema) 
Solucionado
 Ford Ecosport  2015 · 10000 kms
A los 3 meses no subio una pequeña pendiente de un parqueo subterraneo, la lleve al representante no encontraron el problema,le instalaron un scanner por un mes y no reportaron la causa,lo ha hecho 4 veces que se queda que no se mueve ,indico en una ocasion calentamiento de transmision. En otra 2 ocasiones en carretera ha encendido las luces que alertan de problemas en el motor. El aire se le va aveces, el radio se le va de un lado el sonido, pero todo esto es muy ocasionalmente por lo que deje el vehiculo en el concesionario Viamar tengo 45 dias sin vehiculo.
AF
A FRIASRepública Dominicana
hace 22 días
y otras 2 personas con el mismo problema
Respuestas de la comunidad
En el 2011 empezaron a usarlas en el fiesta y focus ,ya la estan montando en todas sus unidades a pesar de presentar multiples fallas y defectos. La transmisión Powershift de Ford es la apuesta de la marca para bajar tanto el consumo de combustible y la emisión de gases contaminantes en sus autos nuevos, más específicamente en los modelos Fiesta y Focus de nueva generación. Esta caja automática robotizada, utiliza la tecnología de doble embrague –o clutch- que también utilizan otras marcas, sólo que ésta es más compacta y ofrece algunas otras ventajas que detallaremos más adelante.
¿Cómo funciona?
Esta parte puede ser un poco tediosa, pero trataremos de hacerlo de la manera más amena posible para describir su funcionamiento. Todas las transmisiones modernas –automáticas o manuales- cuentan con dos trenes de engranes, uno para las velocidades pares (2ª, 4ª y 6ª) y otro para las nones (1ª, 3ª y 5ª). Estos trenes reciben el torque del motor mediante el disco del volante inercial (que a la vez está conectado al cigüeñal que a su vez recibe el impulso de los pistones) pero para cambiar entre un tren y otro, el embrague separa momentáneamente un tren para engranar el otro. Esta tarea se puede realizar mecánicamente (transmisiones manuales), hidráulicamente (transmisiones automáticas convencionales) o eléctricamente (transmisiones robotizadas) pero al contar con un solo clutch o embrague, la tarea es más lenta. Aquí es donde las transmisiones de doble embrague entran en acción pues al tener un embrague para cada uno de los trenes se pueden separar las tareas de desacoplamiento y acoplamiento para cada uno de ellos, logrando que los cambios sean prácticamente instantáneos. La forma en que lo hace es la siguiente: suponiendo que el auto arranca en primera velocidad, el usuario acelera hasta que el motor llega a un determinado número de rpm (dependiendo de la situación y cuánto está presionando el conductor el pedal del acelerador, pueden ser más o menos revoluciones por minuto del motor), entonces la computadora manda la señal a los motores eléctricos de la transmisión Powershift y al mismo tiempo que el clutch para las velocidades nones (1ª, 3ª y 5ª) desacopla el tren de éstas, el otro embrague acopla el tren de las velocidades pares (2ª, 4ª y 6ª). Todo esto sucede en fracciones de segundo así que el motor prácticamente se mantiene en la misma curva de torque y no tiene que volver a empezar desde abajo para recuperar el impulso. Esto se traduce en un mejor aprovechamiento de la energía del motor, un menor consumo de combustible y menor producción de gases contaminantes.
Otras ventajas de esta transmisión son las siguientes:
-Gracias al diseño compacto y a la falta de sistema hidráulico, la Powershift ahorra 70 kg en el peso total del auto (menos componentes y menos fluidos). -La caja es más compacta gracias a los actuadores electromecánicos que sustituyen a los hidráulicos para mover los trenes de velocidades, esto le permite ocupar menos espacio bajo el cofre y acomodar más fácilmente los demás componentes del motor. -La transmisión viene sellada de fábrica, gracias a que el único fluido que contiene es el que lubrica la parte interna, además los actuadores que mueven los trenes de velocidades son eléctricos convirtiéndola en una transmisión libre de mantenimiento por hasta 10 años. -Gracias a que los embragues son controlados por una computadora y no por un humano, la vida de las pastas se prolonga mucho más, así que el clutch se cambia cada 10 años en un escenario óptimo.
Como todo, también existe un lado negativo o por lo menos algunos detalles que se podrían traducir por el usuario como fallas o comportamientos extraños. Éstos son algunos de ellos y sus causas:
-Al ser una transmisión manual robotizada, Powershift no cuenta con fluido hidráulico para su funcionamiento, sólo el aceite que lubrica internamente, entonces los ruidos que se producen al acoplar y desacoplar las velocidades se hacen más evidentes. En una transmisión automática convencional, el fluido y el mismo sistema aíslan estos ruidos. -Al apagar el motor, la transmisión tiene que prepararse para cuando el auto se vuelva a encender, así que en algunas ocasiones se pueden escuchar ruidos de la transmisión aunque el motor se haya apagado. No es ninguna falla, sino que la Powershift se está moviendo internamente para quedar en una posición ideal para el arranque. -Como su accionamiento es más parecido al de una transmisión manual que al de una automática convencional, la Powershift de Ford puede provocar que el auto se mueva hacia atrás cuando el freno no se aplicó y el sistema de ayuda en pendientes no frenó el auto, tal como lo pasaría con una caja manual. Es cuestión de acostumbrarse pues bajo ninguna circunstancia el auto avanzaría mucho, antes el sistema entra en acción y engrana la primera velocidad o la reversa según sea el caso.
Ford está continuamente trabajando para mejorar el funcionamiento de la Powershift y aislar los ruidos que se producen durante los cambios o los raros casos en los que se llega a calentar el sistema. Aproximadamente, dos o tres veces al año se realizan ajustes en la programación de la computadora de la transmisión y cada que el usuario lleva su auto a la agencia para servicio, se actualiza el software de la transmisión a la versión más reciente. Son defectos de diseño de transmisiones de fabrica de ford. Que no termina de perfeccionar, por lo que aumento a 10 años de garantia. Llevalo al distribuido ford
hace 21 días
Mejor solución  (según A FRIAS, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · 48000 kms
Se cambiaron inyectores porque no pasaron las pruebas, quedaban tres goteándole y uno con chorro, inicialmente bien y a la semana se repitió lo mismo con los nuevos, se enciende nuevamente el check e incluso en ciertos casos hay que darle arranque en dos o tres oportunidades (start). Que estará pasando, gracias.
AL
AlcarColombia
hace 22 días
y otras 3 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2012 · xls · 111000 kms
Empezo a levantar temperatura, electro enciende,agua normal, cual puede ser el problema?
OS
oscarArgentina
hace 24 días
y otras 2 personas con el mismo problema
Respuestas de la comunidad
El termostato no esta abriendo correctamente.
hace 24 días
Mejor solución  (según oscar, el autor del problema) 
Pudiera ser la tapa del deposito de agua o la apertura del termostato si el motor es duratec 2.0 el termostato esta ubicado al lado de la correa del motor abajo del camarin o multiple de admision
hace 13 días
Mejor solución  (según oscar, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 53200 kms
Tengo dos problemas el primero la pongo en marcha la dejo regulando y empieza a fallar y se pone en tres cilindros la apago la prendo y anda perfecto pero el check queda prendido asi lo hace en algún semáforo mientras espero pero si la acelero un poco no lo hace solo el check que estaba prendido fijo comienza a titilar y luego se queda prendido. Segundo empasta bujías unos me dicen aros otros la tapa pero jamas fue recalentada ni mal trtada tiene 54000 km y Ricardo me había dicho que le mida la compresión eso esta bien ayer le cambie el escape se había picado la tengo de 0 km
CL
claudioArgentina
hace 24 días
y otra persona con el mismo problema
Respuestas de la comunidad
Hay que escanearla para saber que esta fallando especificamente.
hace 24 días
Mejor solución  (según claudio, el autor del problema) 
Ppdria ser la bobina
hace 21 días
Mejor solución  (según claudio, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 101250 kms
Cuando la enciendo empieza a acelerase, como a los 5 minutos de andar en calle vuelve a acelerar y se apaga en el tablero marca el aceite y la aguja de la temperatura se queda como loca, la vuelvo a arrancar y anda sin problema todo el dia, esto solo lo hace en el primer arranque del dia, ya le cambiaron la bobina, cable y revizaron la bujia...?
FE
Ferras2México
hace 25 días
y otras 3 personas con el mismo problema
Respuestas de la comunidad
La bateria ya no retiene carga ,llevala a un centro de servicio lth a diagnostico electronico , es sin costo.
hace 24 días
Mejor solución  (según Ferras2, el autor del problema) 
Estas fallas son muy comunes solo basta llebar a cabo un buen diagnostic0
Para solucionar el problema pongase en contacto 55 62486568
hace 22 días
RosanaMi auto es un corsa. L e cambie las bujías pero no los cables puede ser que por eso pega tirones
hace 17 días
Mejor solución  (según Ferras2, el autor del problema) 
Mejor solución  (según Ferras2, el autor del problema) 
Ya le revizaron la bateria y aun esta en buenas condiciones, segun le entra aire al motor, se revizo el multiple de admision, le ajustaron la "mariposa", pero aun persiste el problema
hace 22 días
Mejor solución  (según Ferras2, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 443200 kms
Cuando estoy en cola coloco la primera velocidad para avanzar un poco y se queda travada la palanca que tengo que apagar el motor para sacar la velocidad hace 10 dias le cambie el kit de embrague completo el collarin estaba destruido? que puede ser eso que se daño el collarin hidraulico de nuevo porque el varillaje esta perfecto, espero su repuesta gracias
MI
miguel ruizVenezuela
hace 25 días
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Que marca de kit se le puso ? luk.
hace 24 días
Mejor solución  (según miguel ruiz, el autor del problema) 
No conseguí luk coloque uno marca vortex supuestamente americano
hace 24 días
Mejor solución  (según miguel ruiz, el autor del problema) 
Es chino y lo empacan como americano
hace 24 días
Mejor solución  (según miguel ruiz, el autor del problema) 
Hola tengo el mismo problema con la primera y segunda velocidad se queda trabada y aveces destraba me dicen que pueda ser el plato presor que cuando calienta pierde la presion y tiene un mes de haber cambiado el cloche si alguien sabe algo por favor
hace 8 días
Mejor solución  (según miguel ruiz, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 4puertas  · 155000 kms
Últimamente se me esta encendiendo la luz de la batería muy seguido y permanece encendido el motorcito amarillo en el tablero. Y después se apaga en movimiento y luego enciende sin problema.
CH
chuchoVenezuela
hace 25 días
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Hay que resoldar los pines de la tableta electronica donde va el arnes de conexión
hace 24 días
HfrancoEs una irresponsabilidad dar un diagnóstico como ese con tan pocos detalles a cerca de la falla, soy ing electronico y tengo una eco y la conozco de arriba a abajo y por ambas experiencias debo decir que lo que dices es ilogico e irresponsable
hace 14 días
Mejor solución  (según chucho, el autor del problema) 
Mejor solución  (según chucho, el autor del problema) 
Le desconecte la batería y se soluciono lo de las luces. Y el motivo por el cual se apagaba en marcha era por que tenia un corto en el conector externo de la bomba de gasolina.
hace 16 días
Mejor solución  (según chucho, el autor del problema) 
Hendrickson
Eso fue lo que hice después de descubrir como se sacan las agujas para poder acceder a la tarjeta, solo resolde los pines del conector de la tarjeta y listo, aun esta en periodo de prueba pero después de 24 horas no ha vuelto a fallar
Gracias

Responder
Hace 18 horas
hace 14 días
Mejor solución  (según chucho, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 18700 kms
Pare normamente y a las dos horas le doy arranque y anda todo tablero burro de arranque pero no prende el motor
MA
marceloArgentina
hace un mes
y otras 10 personas con el mismo problema
Respuestas de la comunidad
Verifica si cuando abres el switch con la llave puedes escuchar la bomba de gasolina activandose, si no se escucha puede ser que la bomba esté deficiente, si no sabes dónde está la bomba, está debajo de uno de los asientos traseros
hace 14 días
Mejor solución  (según marcelo, el autor del problema) 
Hfranco era un corte en el relay del gas el que utilizan para que la bomba no trabaje en vacio era entonces que la bomba no trabajaba al dar arranque para encontrar dicho desperfecto fui al electricista gracias x la buena onda!!!
hace 14 días
Mejor solución  (según marcelo, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 30000 kms
Hola disculpen, mi problema es cuando queda caliente el motor empieza a sacar humo azul y tiene un ruido como a cadenas, hace poco se le cambió los sellos de válvula sin bajar el cabezote. Creen q tenga q bajar el cabezote para q lo rectifique???
QU
QuiqueMéxico
hace un mes
Respuestas de la comunidad
Hay que cambiar la valvula pcv (valvula de ventilacion del carter) esta en la tapa de punterias conectada a una manguera que va a la admision. Hay que cambiar el tensor de la cadena de distribucion y posiblemente tambien la cadena original.
hace un mes
QuiqueRicardo no ubicó esa valvula
hace un mes
Mejor solución  (según Quique, el autor del problema) 
Mejor solución  (según Quique, el autor del problema) 
Probablemente ese motor sea 2.0 y no la traiga y venga con valvula egr
hace un mes
Mejor solución  (según Quique, el autor del problema) 
Si fue la válvula PCV gracias Ricardo
hace 18 días
Mejor solución  (según Quique, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · 2.0 · 2000 kms
Se encendió la luz de "alerta de motor" y quedó encendida. El vehículo no manifiesta ninguna falla. Anduve más de 30 Km. y no se ve que tenga ningún problema. ¿qué puede ser). Perdón son 200.000 Km.
SA
SamuelArgentina
hace un mes
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Modo de Autocomprobación, para pasar al modo de autocomprobación del cuadro de instrumento haga lo siguiente:

1. Pulse y mantenga pulsado el botón de puesta a cero del cuentakilómetros parcial (RESET) y, a continuación, ponga el contacto en la posición II ó III.
2. Suelte el botón de puesta a cero del cuentakilómetros parcial cuando aparezca TEST en la pantalla de cristal líquido (LCD). Esto tarda entre cinco y ocho segundos. 3. El cuadro de instrumentos realiza la prueba de potenciómetro del indicador.4. Para pasar a las siguientes pruebas mientas se está en el modo de autocomprobación, pulse el botón de puesta a cero (RESET).5. La autocomprobación se desactiva cuando se desconecta el contacto (OFF). Un consejo: Cuando leas la palabra DTC en la pantalla, debe poner NONE, si pone algun numero es q hay algun tipo de error.
hace un mes
SamuelLa luz se apagó sola y no se volvió a encender (después de andar otros 50 KM). Leyendo otros post realicé la autocomprobación y todo estaba bien. Gracias de todos modos.
hace un mes
Mejor solución  (según Samuel, el autor del problema) 
Mejor solución  (según Samuel, el autor del problema) 
Solucionado
 Ford Ecosport  2014 · Titanium 1.6 · 3600 kms
Y nuevamente me aparece motor averiado, tracciòn trasera desconectada y pendiente apagado, tiene 3600 KM. titanium,modelo 2014
WA
walterArgentina
hace un mes
Respuestas de la comunidad
Alguièn puede asesorarme que hacer?
hace un mes
Mejor solución  (según walter, el autor del problema) 
Ricardo
En el 2011 empezaron a usarlas en el fiesta y focus ,ya la estan montando en todas sus unidades a pesar de presentar multiples fallas y defectos. La transmisión Powershift de Ford es la apuesta de la marca para bajar tanto el consumo de combustible y la emisión de gases contaminantes en sus autos nuevos, más específicamente en los modelos Fiesta y Focus de nueva generación. Esta caja automática robotizada, utiliza la tecnología de doble embrague –o clutch- que también utilizan otras marcas, sólo que ésta es más compacta y ofrece algunas otras ventajas que detallaremos más adelante.
¿Cómo funciona?
Esta parte puede ser un poco tediosa, pero trataremos de hacerlo de la manera más amena posible para describir su funcionamiento. Todas las transmisiones modernas –automáticas o manuales- cuentan con dos trenes de engranes, uno para las velocidades pares (2ª, 4ª y 6ª) y otro para las nones (1ª, 3ª y 5ª). Estos trenes reciben el torque del motor mediante el disco del volante inercial (que a la vez está conectado al cigüeñal que a su vez recibe el impulso de los pistones) pero para cambiar entre un tren y otro, el embrague separa momentáneamente un tren para engranar el otro. Esta tarea se puede realizar mecánicamente (transmisiones manuales), hidráulicamente (transmisiones automáticas convencionales) o eléctricamente (transmisiones robotizadas) pero al contar con un solo clutch o embrague, la tarea es más lenta. Aquí es donde las transmisiones de doble embrague entran en acción pues al tener un embrague para cada uno de los trenes se pueden separar las tareas de desacoplamiento y acoplamiento para cada uno de ellos, logrando que los cambios sean prácticamente instantáneos. La forma en que lo hace es la siguiente: suponiendo que el auto arranca en primera velocidad, el usuario acelera hasta que el motor llega a un determinado número de rpm (dependiendo de la situación y cuánto está presionando el conductor el pedal del acelerador, pueden ser más o menos revoluciones por minuto del motor), entonces la computadora manda la señal a los motores eléctricos de la transmisión Powershift y al mismo tiempo que el clutch para las velocidades nones (1ª, 3ª y 5ª) desacopla el tren de éstas, el otro embrague acopla el tren de las velocidades pares (2ª, 4ª y 6ª). Todo esto sucede en fracciones de segundo así que el motor prácticamente se mantiene en la misma curva de torque y no tiene que volver a empezar desde abajo para recuperar el impulso. Esto se traduce en un mejor aprovechamiento de la energía del motor, un menor consumo de combustible y menor producción de gases contaminantes.
Otras ventajas de esta transmisión son las siguientes:
-Gracias al diseño compacto y a la falta de sistema hidráulico, la Powershift ahorra 70 kg en el peso total del auto (menos componentes y menos fluidos). -La caja es más compacta gracias a los actuadores electromecánicos que sustituyen a los hidráulicos para mover los trenes de velocidades, esto le permite ocupar menos espacio bajo el cofre y acomodar más fácilmente los demás componentes del motor. -La transmisión viene sellada de fábrica, gracias a que el único fluido que contiene es el que lubrica la parte interna, además los actuadores que mueven los trenes de velocidades son eléctricos convirtiéndola en una transmisión libre de mantenimiento por hasta 10 años. -Gracias a que los embragues son controlados por una computadora y no por un humano, la vida de las pastas se prolonga mucho más, así que el clutch se cambia cada 10 años en un escenario óptimo.
Como todo, también existe un lado negativo o por lo menos algunos detalles que se podrían traducir por el usuario como fallas o comportamientos extraños. Éstos son algunos de ellos y sus causas:
-Al ser una transmisión manual robotizada, Powershift no cuenta con fluido hidráulico para su funcionamiento, sólo el aceite que lubrica internamente, entonces los ruidos que se producen al acoplar y desacoplar las velocidades se hacen más evidentes. En una transmisión automática convencional, el fluido y el mismo sistema aíslan estos ruidos. -Al apagar el motor, la transmisión tiene que prepararse para cuando el auto se vuelva a encender, así que en algunas ocasiones se pueden escuchar ruidos de la transmisión aunque el motor se haya apagado. No es ninguna falla, sino que la Powershift se está moviendo internamente para quedar en una posición ideal para el arranque. -Como su accionamiento es más parecido al de una transmisión manual que al de una automática convencional, la Powershift de Ford puede provocar que el auto se mueva hacia atrás cuando el freno no se aplicó y el sistema de ayuda en pendientes no frenó el auto, tal como lo pasaría con una caja manual. Es cuestión de acostumbrarse pues bajo ninguna circunstancia el auto avanzaría mucho, antes el sistema entra en acción y engrana la primera velocidad o la reversa según sea el caso.
Ford está continuamente trabajando para mejorar el funcionamiento de la Powershift y aislar los ruidos que se producen durante los cambios o los raros casos en los que se llega a calentar el sistema. Aproximadamente, dos o tres veces al año se realizan ajustes en la programación de la computadora de la transmisión y cada que el usuario lleva su auto a la agencia para servicio, se actualiza el software de la transmisión a la versión más reciente. Son defectos de diseño de transmisiones de fabrica de ford. Que no termina de perfeccionar, por lo que aumento a 10 años de garantia. Llevalo al distribuido ford
hace un mes
Mejor solución  (según walter, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · Asientos de piel a/c · 142300 kms
Cuando paso un tope y voy en primera velocidad le piso el acelerador o asi mismo en una subida se escucha una explosión en el filtro de aire quisiera saber q le estuviera fallando lla le cambie el sensor mariposa
AL
Alejandro ferriMéxico
hace un mes
y otras 5 personas con el mismo problema
Respuestas de la comunidad
Amigo a mi me pasa igual. En mínimo el carro tiene un brinco y cuando enciendo el aire se intensifica mas la falla. Le cambie el sensor TPS, la bobina, se limpio el cuerpo de aceleracion, se reviso bujías e inyectores y están bien, al igual que los cables. Para arrancar no tiene fuerza y en alta también se siente un jaloneo.
hace un mes
Alejandro ferriExacto eso mismo le pasa a mi eco espero alguna solucion
hace un mes
Mejor solución  (según Alejandro ferri, el autor del problema) 
Mejor solución  (según Alejandro ferri, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 160000 kms
El vehiculo arranca sin inconveniente, pero se queda sin corriente, lo que obviamente hace que se pare el motor, le cambie el contactor y sigue igual, tengo que intentar varias veces y hasta mover la llave en el tambor hasta que encienden todos los testigos y queda en normal. Se me ocurre que pueda ser el tambor de arranque, si alguien ha tenido este problema, quisiera saber como lo soluciono, gracias
CA
candidoArgentina
hace un mes
y otras 3 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2005 · 200000 kms
Tiene como seis meses que a mi eco le salio un zumbido cuando le entra la tercera velocidad. Lo lleve con varios mecanicos y cada uno me sugirio lo siguiente: cambio de bomba de direccion hidraulica. Cambio de banda de motor y poleas, cambio de discos, baleros de ruedas, amortiguadores, alineacion, balatas, radiador, etc. y hasta ahorita eze zumbido le sigue, no ha tenido problemas con el clutch y hace bien los cambios. ¿alguien me puede ayudar? Se lo voy a agradecer...
JU
JUAN MARTINMéxico
hace un mes
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Ya se reviso el nivel de aceite a la transmision ? con ese kilometraje lo recomendable es cambiarselo.
hace un mes
JUAN MARTINSi Ricardo gracias, el aceite le fue cambiado el mecanico le puso bardhal 80.90 y se llevo como un galón y el ruido sigue...¿que podra ser? Espero tu respuesta
hace un mes
Mejor solución  (según JUAN MARTIN, el autor del problema) 
Mejor solución  (según JUAN MARTIN, el autor del problema) 
Seguramente el mecanico compro el aceite BARDAHL. O me equivoco?
La especificacion del aceite es WSD-M2C200-C2 aceite sintetico de alta presion 75w90 MOTORCRAFT
hace un mes
JUAN MARTINOk. Asi le haremos y luego te platico...
hace un mes
Mejor solución  (según JUAN MARTIN, el autor del problema) 
JUAN MARTINAmigo ricardo: ya le cambiaron el aceite por el especificado. La acabo de probar en tercera, cuarta y quinta y el zumbido sigue...¿que hago?
hace un mes
Mejor solución  (según JUAN MARTIN, el autor del problema) 
Mejor solución  (según JUAN MARTIN, el autor del problema) 
Hay que observar donde y como se produce el zumbido si es circulando pueden ser baleros de rueda o de la barra homocinetica de traccion, hay que alzarlo y acelerarlo para detectar si es por esto. Tambien zumban las llantas cuando se pasan de la presion indicada o tienen un desgaste disparejo
Si estacionado zumba ,puede ser balero de alternador o bomba de agua.
hace un mes
Mejor solución  (según JUAN MARTIN, el autor del problema) 
Estimado Ricardo: Descarto poco a poco acerca de lo que dices, el zumbido es circulando y en neutral; zumba cuando la acelero en 3a, 4a, 5a. Ya la levantaron y la aceleraron no se cuantas veces de las cuatro ruedas y no zumba. Acabo de alinear hace 15 dias por si eran las llantas y estan a buena presion; sacaron y analizaron la flecha larga y todo esta correcto no desgastado; balero de alternador nuevo, bomba de agua nueva y bomba de direccion hidraulica nueva...¿que podra ser? Espero tu respuesta...
hace un mes
Mejor solución  (según JUAN MARTIN, el autor del problema) 
No queda de otra, deben ser baleros de la transmision
hace un mes
Mejor solución  (según JUAN MARTIN, el autor del problema) 
A los mecanicos que checan la ecosport no los convence la idea de que sean baleros de transmision por que dicen que esos silvan, no zumban. ¿Como puedo convencerlos de que chequen lo que me dices? ¿que les puedo decir? Aconsejame algo...Hoy le van a cambiar los amortiguadores delanteros y el balero lado rueda derecha...Mañana te platico...
hace 25 días
HfrancoAmigo has una prueba simple, levanta la camioneta, ponla en neutro y gira las ruedas manualmente mientras pones la mano en el gusrdafango, (en la carroceria sobre la rueda) si suena la rueda al girar, y la sientes una vibración en la mano que estas apoyando, entonces el rodamiento de esa rueda esta malo
hace 14 días
Mejor solución  (según JUAN MARTIN, el autor del problema) 
Mejor solución  (según JUAN MARTIN, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 200000 kms
Encendió sin problema en la mañana, la circule unos 20 kilómetros, la apague y ya no volvió a encender. Quise prenderla de empujón y tampoco. Note que al abrir el switch no encendieron las luces del tablero: gasolina, motor, etc., únicamente estuvo parpadeando el candado de alarma, ¿Qué podrá ser?, en el taller no le han encontrado por el momento, ¿alguno de ustedes me podría orientar? Gracias.
LO
loxoscelesMéxico
hace un mes
y otras 11 personas con el mismo problema
Respuestas de la comunidad
Si las luces estan debiles y amarillentas , los wipes van lentos ,si ya tiene mas de año y medio de uso puede ser la bateria
hace un mes
Mejor solución  (según loxosceles, el autor del problema) 
Solucionado
 Ford Ecosport  2003 · 2.0 · 215000 kms
El bulbo de presión de aceite no marca falla. Pero hacen ruidos los botadores y no llega el suficiente aceite. Revise la bomba filtro y conductos de aceite y todo normal, me esta volviendo loco
GE
GermanArgentina
hace un mes
Respuestas de la comunidad
Que aceite se le puso al motor y que temperatura ambiente hay en tu ciudad. Puede ser que se le puso un aceite inadecuado al motor.
hace un mes
GermanEl aceite es el total 4400 hace dos @ños que uso el mismo y nunca habia tenido probleas. La bomba esta un poco rallada. Podria ser eso? Pero fallaria en baja no en alta segun mi conocimiento.
hace un mes
Mejor solución  (según German, el autor del problema) 
Mejor solución  (según German, el autor del problema) 
Con ese kilometraje debe ser la bomba de aceite , hay que medir la presion de aceite con un manometro para confirmarlo.
hace un mes
GermanYa la pedí mañana le cuento, después de cambiarla, raro, pero espero sea la solución, gracias. Saludos
hace un mes
Mejor solución  (según German, el autor del problema) 
Mejor solución  (según German, el autor del problema) 
Solucionado
 Ford Ecosport  2003 · 2.0 · 215000 kms
Tengo una Eco 2.0 y de repente dejo de tirar aceite arriba. No cargan los botadores. Revise los conductos y no están tapados, abajo, osea lo cojinetes están bien, la distribución también. La bomba de aceite la desarme esta un poco rallada. Pero no la veo como para que no tire aceite arriba, el filtro esta bien y no me marca la falla de presión de aceite en el tablero. Pero no cargan ninguno de los 16 botadores, alguien tiene idea que sera?
GE
GermanArgentina
hace un mes
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2013 · 1.6 · 80000 kms
Hola...Me paso que iva lo mas normal y ya hace como dos años que me pasa lo mismo. Falla de abs y se apaga el motor y todo el sistema cambie la bateria 2 veces aguanta con suerte 8 meses y vuelve a pasar lo mismo y aparte se desconfigura la radio y el sinc... Pero hace dos semanas desconecte la bateria y la radio y sinc quedaron igual y nunca mas funfionaron... Y en la concesionaria no me dieron respuestas... Si alguien le paso esto por favor que me ayude... Antes yo desconectaba la bateria esperaba 30 minutos y se arreglaba ahora lo hago y queda igual... Y mi bateria es de 55000 mp...
LU
luis alejandroChile
hace un mes
y otras 10 personas con el mismo problema
Respuestas de la comunidad
El electro ventilador funciona en baja y alta pero me empieza un gorgoreo del agua del envase de enfriamiento y pierde agua. Que puede ser
hace un mes
Mejor solución  (según luis alejandro, el autor del problema) 
Compra una bateria de 65 amp y adios problema
hace un mes
Mejor solución  (según luis alejandro, el autor del problema) 
A mi me pasa que anda todo sync todo pero no suena. Ni tampoco el sensor de estacionamiento suena. Anda todo reconoce voz todo va bien solo no emite sonido. Una vez probe de desconectar la bateria y luego de dos dias sono normal pero al tiempo dejo nuevamente de sonar y ya no lo pude solucionar mas ni desconectan la bateria.
hace 25 días
Mejor solución  (según luis alejandro, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · Ecosport XLt 2.0 · 72000 kms
Hola mi eco es 2.0 cuando empieza andar empieza a parpadear la luz de avería la cual la tengo siempre encendía y después de unos minutos pone en falla el motor , lo apago y enciendo y se le va pero luego vuelve hacer lo mismo , lo hace con gnc y gasolina recién le hice la tapa cambiando válvulas pero igual me lo hace
GA
GachobautiArgentina
hace un mes
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2005 · 187000 kms
Hola tengo un vehículo Ford ecoesport 2005 sabe q en el tablero no me indica el medidor de la temperatura del motor y el medidor de combustible marca solo en partes y en otras se hace como puntos ciegos q debo hacer porque las demás funciones del tablero están bien solo estos dos inconvenientes tenemos...alguien podría decirme q debemos hacer porque le llevamos a q nos den escaneando y no se soluciono el problema, nos dijeron q debemos cambiar el tablero completo pero no creo q sea necesario eso porque todo lo demás funciona bien
KA
KattyEcuador
hace un mes
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Pues es solo una posibilidad, pero para descartar revisa que el flotador de la bomba de gasolina esté en buen estado, quizas son dos problemas diferentes aislados, ya por último si eso no funciona debe ser que la LCD que muestra la gasolina y la temperatura está dañada y no se si se pueden reemplazar
hace 14 días
Mejor solución  (según Katty, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 70000 kms
Pérdida de aceite por la parte de atrás motor
AR
arturoUruguay
hace un mes
y otra persona con el mismo problema
Respuestas de la comunidad
Hay que observar de que color es el aceite que fuga si es obscuro es de motor , si es claro es de transmision. Al estacionar en la noche pon periodicos abajo
hace un mes
Mejor solución  (según arturo, el autor del problema) 
Hola tengo una ecosport 2011 mi problema es que ase un ruido cuando dejo de precionar en embrague. Cuando lo presionó el ruido desaparece... que podría ser??
hace un mes
Mejor solución  (según arturo, el autor del problema) 
Puede ser el collarin hidraulico del embrague.
hace un mes
Mejor solución  (según arturo, el autor del problema) 
Hola, Tengo una ecoesport, 2005, diésel 1.4...le hicieron el motor a nuevo, hasta el llamado,...árbol de eleva... se puso nuevo, todo el sistemas electrónico a nuevo,...Pero pierde... aceite... no mucho, pero deja una mancha al estar estacionada...
Necesito una recomendación , desde ya muchas gracias...
hace 18 días
Mejor solución  (según arturo, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 4puertas full motor 2.0 16 val  · 195500 kms
Se me quemo un inyector por usar gas de la computadora no llegaba pulso y la puentiarion y anda ahora el motor es un dametec 2.0 16 válvulas se puede conseguir la computadora gracias
EL
el panaArgentina
hace un mes
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2008 · 5 puertas  · 80000 kms
Hola, mi auto no ha podido pasar la verificación porque prende el foco de Check engine y ya lo llevé a revisar y servicio... Se lo borran y vuelve a aparecer... A dónde lo tengo que llevar?
HE
Helena México
hace un mes
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Llevalo a escanear a un autozone, es sin costo.
hace un mes
MatyHola ricardo ala eco se le puede cambiar la luz del tablero? Tiene verdes yo quiero ponerle unos LED blancos
hace un mes
Mejor solución  (según Helena , el autor del problema) 
MatyHola ricardo ala eco se le puede cambiar la luz del tablero? Tiene verdes yo quiero ponerle unos LED blancoshol
hace un mes
Mejor solución  (según Helena , el autor del problema) 
HfrancoSi puedes, solo debes desarmar el tablero y cambiar los LEDS pero personalmente aconsejaria no hacerlo
hace 14 días
Mejor solución  (según Helena , el autor del problema) 
Mejor solución  (según Helena , el autor del problema) 
Mejor ni le muevas , el sistema electrico de esas camionetas ,por cualquier motivo falla, principalmente por de fabrica les ponen baterias insuficientes (45 amps. ) y un equipamiento mayor a esa capacidad, presentando infinidad de fallas electricas que prenden todos los testigos del tablero, se apaga totalmente y te deja tirada en cualquier momento
hace un mes
Mejor solución  (según Helena , el autor del problema) 
-1
No es recomendable ya te explique porque.
hace un mes
Mejor solución  (según Helena , el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 119000 kms
Buenas,
Tengo una ecosport 2006, han salido algunas fallas, ultimamente (2016) el pedal se está yendo al fondo de forma intermitente, lo que tengo que hacer es volver a presionar el pedal, pero me mantiene tenso. No veo derrame de líquido de frenos ni debajo del motor, ni por donde está el pedal.
Una vez tuve que cambiar la bomba que está en el pedal, pero era porque había fuga de líquido. La lleve a la agencia hace una semana, me dijeron que estaba bien.
¿Alguien con un problema parecido?
BA
baoengbMéxico
hace un mes
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Puede ser el collarin hidraulico del clutch, que predio presion
hace un mes
baoengbHola Ricardo. Gracias por tu comentario, ¿será necesario cambiar el collarín?
hace un mes
Mejor solución  (según baoengb, el autor del problema) 
Mejor solución  (según baoengb, el autor del problema) 
Con 10 años de uso y ese kilometraje se recomienda cambiar el kit de clutch completo para que no vuelva a fallar
hace un mes
baoengbHola, le cambiente el kit completo hace como 5 años. Posiblemente se tenga que cambiar de nuevo. ¿es recomendable hacer esto únicamente en la agencia?
hace un mes
Mejor solución  (según baoengb, el autor del problema) 
Mejor solución  (según baoengb, el autor del problema) 
No necesariamente si tiene un buen mecanico de tu confianza, que lo revise bien y confirme si esa es la falla que presenta.
hace un mes
Mejor solución  (según baoengb, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 18000 kms
No da marcha el motor,la bateria si indica carga normal 12.6 vcd,pero no arranca,que podrá ser?
JE
JeshuaMéxico
hace un mes
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Si no starea puede ser el motor de arranque ,ya sea solenoide o carbones gastados
hace un mes
Mejor solución  (según Jeshua, el autor del problema) 
Sigo con el problema,ya cheque la caja de fusibles,el disyuntor de arranque,todo bien,di carga a la bateria,de 12.5 subió a 13.4 volts y ni así quiso encender el motor. Será mejor checar bien la marcha.
hace un mes
Mejor solución  (según Jeshua, el autor del problema) 
Solucionado
 Ford Ecosport  2016 · Titanium  · 550 kms
Me subí y está en parking, apretó freno para darle Staricco y no prende
EM
EmiroUruguay
hace un mes
y otras 6 personas con el mismo problema
Respuestas de la comunidad
Son defectos de calidad de fabrica ford. Sobre todo las titanium. Tiene garantia ,avisa que te la vayan a revisar al distribuidor. Revisa si el tapete no esta interfiriendo con el pedal de freno para conectar el interruptor de encendido.
hace un mes
Mejor solución  (según Emiro, el autor del problema) 
Solucione tema, les comento que estaba el borne positivo (batería) "prendido en un hilo" y no le daba para circular la corriente. La verdad que una falta de todo un poco al pasar esto en un vehiculo 0 km.
Lo las triste aun el representante de Ford en Uruguay (Multimotors) me dejo dos días tirado sin solucionarme el tema y ni fueron capaces de al menos hacer una llamada. Como cliente de Ford expreso mi descontento con toda la atención.
hace un mes
Mejor solución  (según Emiro, el autor del problema) 
Buenas tardes el carro no enciende ya probamos con el tapete y también con la batería. Apenas tiene 10 meses
hace un mes
Mejor solución  (según Emiro, el autor del problema) 
Es muy lamentable que los ford desde nuevos esten presentando tantos defectos, reportalo al distribuidor para que lo vayan a revisar en donde quedo. Tiene garantia
hace un mes
Mejor solución  (según Emiro, el autor del problema) 
Sigo con los problemas en mi titanium con casi 1000 kmts, en la región que vivo llueve desde hace una semana y me he dado cuenta que tengo una "piscina" en la camioneta. En los pies del asiento de atrás lado derecho esta toda la moquete mojada. Lo seque pero se sigue mojando y ahora junto mucha agua. La verdad un desastre FORD con estos detalles
hace un mes
Mejor solución  (según Emiro, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 130000 kms
Se encienden los señalamientos de temperatura, seguro y check engine del tablero y se alocan las medidores de velocidad y revoluciones, medición de temperatura
PU
Puma57México
hace un mes
y otras 6 personas con el mismo problema
Respuestas de la comunidad
Llevalo a un centro de servico LTH a diagnostico electronico, es sin costo , es muy probable que sea la bateria.
hace un mes
Mejor solución  (según Puma57, el autor del problema) 
-1
Tienes q cambiar la bobina me paso lo mismo y se soluciono
hace un mes
Mejor solución  (según Puma57, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 90000 kms
A veces cuando quiero encender el motor no arranca esta totalmente muerto y parpadea candado del tablero espero unos minutos y funciona, otras veces voy circulando y parpadea luz candado rojo del tablero y se apaga luego enciende de nuevo
RI
RICARDOMéxico
hace un mes
y otras 5 personas con el mismo problema
Respuestas de la comunidad
Ricardo
Si prende el candado, puede ser que no este identificando el chip de la llave, prueba con el duplicado.
hace un mes
Mejor solución  (según RICARDO, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · Motor 2,.0 · 150000 kms
Cuando voy en marcha en los cambios 1,2,3 y 4, la aceleración del carro es perfecto corre muy bien pero cuando meto 5ta pierde demasiada aceleración, aplastó el pedal hasta el fondo y no responde, y tiende a subir la temperatura y dejo de acelerar y normaliza la temperatura de nuevo, ya le cambie el termostato, el catalizador, y le cambie el tapón del deposito de agua (radiador) y tiene los servicios al dia, quisiera saber si alguien sabe que es lo que tiene??
JO
Jorge munguiaMéxico
hace un mes
y otras 2 personas con el mismo problema
Respuestas de la comunidad
En esa transmision la 5a. Es una sobre marcha ,solo para mantener la velocidad ,reducir las RPM del motor y el consumo, no es para rebasar vehiculos por que no tiene el torque para hacerlo.
hace un mes
Mejor solución  (según Jorge munguia, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · 4 puertas motor 1.6 · 145000 kms
A mi camioneta le cambie la bomba del agua , el termostato completo , ahora la temperatura es normal, prende el electro en primera y luego se apaga solo ,
Pero cuando voy de bajanda la temperatura se me va al minimo , luego se pone loco el reloj y prende la luz de la tempratura a rojo , alguien me puede ayudar ? gracias
AL
alexisVenezuela
hace un mes
Respuestas de la comunidad
Hay que cambiar el sensor de temperatura esta defectuoso, consigue el original.
hace un mes
Mejor solución  (según alexis, el autor del problema) 
A ok gracias , lo que pasa amigo ricardo que yo le cambie la tapa del regulador donde esta la valvula , la que tiene es la de plastico , se la cambie por la de hierro o ( hierro forjado ) o aluminio , bueno tu entiendes y la valvula de la de plastico queda floja , ya le cambiamos 3 valvulas de la aluminio es raro que las 3 salgan defectuosas , gracias por tu ayuda
hace un mes
Mejor solución  (según alexis, el autor del problema) 
Hola Ricardo tengo una eco 2008 y tengo el mismo problema de temperatura ya cambie la bomba le saque el termostato cambie los bulbos y el problema sigue es como que si no circulNov el agua te consulto la camioneta ya tiene práctica mente 8 años y nunca pasó eso con la polea original espero una repuesta gracias
hace un mes
Mejor solución  (según alexis, el autor del problema) 
Los conductos del sistema de enfriamiento son muy estrechos, con los 8 años de uso se cierran mas por sarro que se forma por el anticongelante diluido con agua, lo mismo las mangueras ,lo que reducen significativamente el flujo necesario para enfriar el motor eficientemente, es el mal de los FORD el RECALENTAMIENTO. Consigue el anticongelante marca peak rojo que tambien es refrigerante y cambialo, purga bien el sistema a ver si mejora
hace un mes
Mejor solución  (según alexis, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 2.0 · 58000 kms
Buenos dias a todos los del foro.
Tengo una Ecosport 2.0 2007 y tengo un problema con el aire acondicionado y la alarma de check engine. El AA funciona por un tiempo y luego deja de enfriar. Basicamente enfria cuando le da la gana. En el concesionario Ford me dijeron que es la computadora que esta enviando la señal y si cambio el sensor MAP puede solucionar el problema tanto de la alarma de check engine como el
Aa. Queria escuchar sus comentarios al respecto? Muchas Gracias.
EC
ecoccs212Venezuela
hace un mes
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Si lo escanearon y salio el map defectuoso , cambialo los servicios del distribuidor tienen garantia
hace un mes
Mejor solución  (según ecoccs212, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · Eco Sport · 56000 kms
Hace tiempo que la camioneta se consume el aceite, lo pare en un taller mecánico le sacaron el chapon de abajo no caía aceite, se le cambio bulbo y la respiración y sigue consumiendo, cuando lo arranco se pone en tres cilindros y se empasta la bujía la primera a la izquierda ya le cambie 3 , le pongo aceite ypf 15/40 el mejor y uso infignia,
RO
ROBERTOArgentina
hace un mes
y otras 5 personas con el mismo problema
Respuestas de la comunidad
-1
Ese aceite es muy grueso , ese motor lleva 5w 30 motorcraft
hace un mes
Mejor solución  (según ROBERTO, el autor del problema) 
El auto está en el taller , se optó por abrir el motor para ver si es problemas de aros o que otro problema puede ser, cuando termine , comento lo que se encontró y la solución , gracias por su comunicación
hace un mes
marcosA mi me pasa lo mismo espero tu repuesta
hace un mes
Mejor solución  (según ROBERTO, el autor del problema) 
Mejor solución  (según ROBERTO, el autor del problema) 
El problema, fue un recalentamiento, que supuestamente fue del dueño anterior, tenía un aro cortado y otro doblado , este fin de semana lo anduve y todo bien
hace un mes
Mejor solución  (según ROBERTO, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · Ecosport  · 300000 kms
Cuando la aceleró y suelto el pedal del acelerador en gas vajan las revuluciones hasta 600 y comienza a andar en tres cilindro hasta a se recupera y cuando voy en viajando y suelto el acelerador hace explosiones...
LU
LuisArgentina
hace un mes
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Yo tuve un problema similar, probe de mecanico en mecánico hasta que encontre el problema y este era que la conexión electrica/electrónica de uno de los inyectores no estaba bien, es decir, la conexión tipo clam que se tiene en este tipo de motores estaba desgastada y no hacia un buen contacto los terminales. La solución:
Pelar un alambre multi hilos y colocar los mismos en los orificios de la conexion del inyector que no funciona, así al momento de empatar la conexión la misma quedaba sin holgura y por ende habia contacto. Para conocer el inyector dañado debes tener prendido el motor y probar uno por uno los inyectores desconectandolos, así cuando veas que el motor no sufre variación alguna al desconectar un inyector en particular ese es el del problema
hace un mes
Mejor solución  (según Luis, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · Ecosport  · 300000 kms
Cuando la aceleró y siento el pedal del acelerador en gas vajan las revuluciones hasta 600 y comienza a andar en tres cilindro hasta a se recupera y cuando voy en viajando y suelto el acelerador hace explosiones...
LU
LuisArgentina
hace un mes
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2004 · 5 puerta · 210 kms
Mi camioneta se calienta al poco uso cuando la compre aguja no se movia de la mitad ahora a donde quiera que voy y al poco tiempo sibe a 3/4 o hasta el tope cambiamos tapon del deposito de agua ya que np aguantaba presion, pero sigui problema despues paso que el radiador tiraba agua ya que tenia fuga lo sellaron con tapafuga y ya no tiro agua pero sigue calentandose el motor ¿tienen idea de que sera? FORD ECOSPORT 2004
JA
JavierMéxico
hace 2 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Debe ser que no esta abriendo el termostato correctamente, con mucho cuidado cuando apages el motor toca las mangueras del radiador, deben de tener la mima temperatura, si la que va al termostato (derecha) esta mas fria, es el termostato que no abre
hace 2 meses
Mejor solución  (según Javier, el autor del problema) 
Yo yo le saqe el termoestato no le hace nada ?
hace un mes
Mejor solución  (según Javier, el autor del problema) 
En lugares de clima calido aparentemente no le hace falta, pero al no detectar la temperatura ideal la computadora ,dificulta el encendido
hace un mes
Mejor solución  (según Javier, el autor del problema) 
Solucionado
 Ford Ecosport  2015 · Titanium · 2000 kms
Que tal, el problema que tengo que se enciende el indicador de check engine puede durar así por un día o varios y del mismo modo estar sin encender, se llevo a la agencia donde supuestamente con el escaner lo ajustaron y ya no debía de prender, pero sigue igual. Se volvió a llevar y por desgracia se apago cuando iban a recibir el auto y no lo recibieron porque no iba a detectar nada el escaner y como pueden observarse tiene poco kilometraje y el argumento del asesor que esto sucede por falta de uso y que se use mas, que es algo que para mi no es valido. Además últimamente note que sale aire ca…Leer completa
KI
KikeMéxico
hace 2 meses
Respuestas de la comunidad
Son multiples defectos de fabrica ford y mas de ese modelo titanuim. Exige la revision y ajuste sin costo.
hace 2 meses
Mejor solución  (según Kike, el autor del problema) 
Hola Ricardo seguí tu recomendación, se realizo una revisión detallada y quedo el asunto resuelto... Gracias.
hace 23 días
Mejor solución  (según Kike, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · 4 puertas · 50000 kms
Hola andando perfectamente por la ruta bajo la velocidad y se acelera subiendo y bajando las revoluciones luego se apago. Despues de dos horas que fue lo que tardo la grua ,me dice que la prenda y arranco pero con la misma falla mas el encendido del electroventilador estando el motor frio. Si alguno tiene una idea de la posible falla por ahora voy a desconectar la bateria para resetear la computadora saludos gente...
PR
primoArgentina
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Revisa la valvula iac (valvula de aceleracion minima) es la que regula las rpm del motor, revisa el sensor de temperatura es el que controla el encendido del ventilador ,no debe de conectalo cuando esta frio. Debe de estar defectuoso.
hace 2 meses
Mejor solución  (según primo, el autor del problema) 
Ok voy a reemplazar el sensor de temperatura del termostato ya que vi que no marca la aguja. Sino que prende la luz de temperatura con el motor recien prendido gracias ricardo
hace 2 meses
Mejor solución  (según primo, el autor del problema) 
Remplazando el bulbo que va en el termostato quedo funcionando de diez mañana lo pruebo en la calle
hace 2 meses
Mejor solución  (según primo, el autor del problema) 
Yo yo le saqe el termoestato no le hace nada ?Holaa yo le saqe el termoestato no le hace nada ? Oh si o si tiene qe tener el termoestato ?
hace un mes
Mejor solución  (según primo, el autor del problema) 
Lo unico que te va a tardar mas en calentar en invierno ,sino cuando pones uno nuevo le realizas un agujero con una mechita chiquita para que pase un poco de agua en el caso que se trabe o te quede pegado
hace un mes
MatyOkei gracias primo y esto no tiene nada qe ver con el radiador !! Te hago una pregunta cuando aprrieto el embrague y pongo el cambio no lo agarra o entran duros que puede ser falta de grasa ??
hace un mes
Mejor solución  (según primo, el autor del problema) 
javierUna pregunta carnal tengo una ecosport en frio jala bien pero al calentarse el motor trato de arrancar y se jalonea al acelerarle y se caen la revoluciones pero sin acelerarla esta bien hasta que quiero avansar y pasacotravez lo mismo y tengo ke apagarla y esperar un rato para que jale bien pero despues de otros minutos hace lo mismo de nuevo
hace 12 días
Mejor solución  (según primo, el autor del problema) 
Mejor solución  (según primo, el autor del problema) 
Maty puede ser la bomba de embrague que esta jodiendo debajo del pedal o el buje de la selectora este gastado o roto y tiene juego esta en donde se carga la grasa
hace 10 días
Mejor solución  (según primo, el autor del problema) 
Solucionado
 Ford Ecosport  2004 · Transmisión manual, 5 vel.  · 230000 kms
Hace unos 7 meses comenzó a acelerarse solo, mientras está detenido todo normal, pero al estar en movimiento se acelera aún estando en neutral, por ejemplo, si estaba detenido en una pendiente no ocurría nada, pero en el momento que soltaba el freno y comenzaba a avanzar se acelera aún estando en neutral hasta 3000 rpm y solo regresaba a la normalidad algunos segundos después de hacer alto total. El mecánico revisó y cambió mangueras de vacío y quedó arreglado. Hace poco más de un mes el problema volvió esta vez subiendo hasta las 4000 rpm y a veces más, se revisaron nuevamente las mangueras y…Leer completa
NA
NashMéxico
hace 2 meses
Respuestas de la comunidad
Ya le revisaron el regulador de presion de combustible ?
hace 2 meses
Mejor solución  (según Nash, el autor del problema) 
Creo que no, podrías darme más datos acerca de eso?
Muchas gracias Ricardo
hace 2 meses
Mejor solución  (según Nash, el autor del problema) 
hace 2 meses
luis PMOla nash cambia el sensor d temperatura es muy provable q este mal y le mande informacion incorrecta a la computadora diciendole q esta frio y se acelere
hace un mes
Mejor solución  (según Nash, el autor del problema) 
Mejor solución  (según Nash, el autor del problema) 
Excelente referencia, desafortunadamente ya se había revisado esa válvula, limpiado e incluso se probó con otra y la falla continúa; gracias por tu interés y ayuda Ricardo.
hace 2 meses
Mejor solución  (según Nash, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 130000 kms
Cada 15 días le ponía 1 litro de aceite. Y sé jaloneaba, la fuga era en el retén del motor y el jaloneo era un problema eléctrico derivado de los cables y la bobina los remplace y todo bien
JU
JurismachMéxico
hace 2 meses
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2010 · 1.6 rocam · 120000 kms
Que ta, mi problema comenzó con el auto que regulaba mal y se apagaba en bajas revoluciones. Mi auto tambien tiene GNC y el sintoma es con los dos tipos de combustible- primero pense combustible vieo o sucio, Luego comenzó a hacer ruido en el escape como si estuviera andando en 3 cilindros con fallas ( el escape suena como una moto y el auto presenta tirones al andar y olor a nafta) efectivamente chequendo una de las bujias no recibe corriente. Cambiamos el cable y nada. Que problema pued etenes? gracias
GA
gabyzeroArgentina
hace 2 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Lo primero es saber si la falla es constante o esporádica
Si el problema es constante seguros tienes la bobina de alta mala (hazlo escanear que seguro te muestra la falla)
En caso de que la falla sea esporádica lo más seguro es un falso contacto de los cables de batería al chasis
hace 2 meses
Mejor solución  (según gabyzero, el autor del problema) 
Tengo el mismo problema no lo ase constante ya le cambié cables bujias y bobina todo original y sigue la falla mia es en el cilindro #2 el meca nico dice que es falla de válvulas pero ya no se que hacer aver si alguien me puede ayudar
hace un mes
Mejor solución  (según gabyzero, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 2.0 litros · 80000 kms
Se apago y al volver a ponerla en contacto se produce un cascabeleo en el relay de la bomba de combustible y en la válvula IAC y no arranca es como si no lllegara combustible
7P
7pelaArgentina
hace 2 meses
y otras 6 personas con el mismo problema
Respuestas de la comunidad
-1
Revisa las terminales de la bateria, que no esten sueltas o sulfatadas. Si tiene mas de año y medio de uso puede ser la bateria.
hace 2 meses
Mejor solución  (según 7pela, el autor del problema) 
Solucionado
 Ford Ecosport  2003 · 180649 kms
Hola buenas noches,el problema es que el vehiculo arranca bien y regula,pero cuando trancito tironea o se apaga el motor,eso pasa cuando quiero subir la velocidad.me dijeron que puede ser el sensor de eselerador,pero no se donde se encuentra,decearia me den una respuesta a mi problema,desde ya se lo muchas gracias,
JO
jorgeArgentina
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Es el sensor tps el que controla electronicamente la aceleracion ,esta en el cuerpo de aceleracion.
hace 2 meses
Mejor solución  (según jorge, el autor del problema) 
Muchas gracias Ricardo. Pero donde se encuentra el cuerpo de aceleración???
hace 2 meses
Mejor solución  (según jorge, el autor del problema) 
El cuerpo de aceleracion es donde termina la manguera del filtro de aire.
hace 2 meses
Mejor solución  (según jorge, el autor del problema) 
Muchas gracias Ricardo!!
hace 2 meses
Mejor solución  (según jorge, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 100000000 kms
No arranca rectificado turbo nuevo inyectores bien bomba bien. Aparece un autito con candado en el tablero que titila
ED
EduardoArgentina
hace 2 meses
Respuestas de la comunidad
Esta activado el inmovilizador de motor (candado) puede ser que no este identificando el chip de la llave , prueba con el duplicado
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Gracias ya voy a probar. Es una opción nueva
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Ricardo fue el único que me tiró una idea.
Así que le hice motor cambie el turbo, la bomba. Y ya arranca. Gracias
hace un mes
Mejor solución  (según Eduardo, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 143000 kms
Hola buenas noches mi problema es el siguiente. Pasa que reyire las bujias para revisarla seguido de esto las volví a instalar pero al encender el vehículo petardea constantemente y empezó a oler oler gasolina que pudo ha ee pasado? Si no lo hacía antes de quitar las bujias?
AL
AlexMéxico
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Se pudo haber perdido el orden de encendido
hace 2 meses
Mejor solución  (según Alex, el autor del problema) 
Tenia fallo un cable, aproveche y cambie bujias de una vez!
El problema desistio. Gracias por la ayuda.
hace 2 meses
Mejor solución  (según Alex, el autor del problema) 
Solucionado
 Ford Ecosport  2016 · 4ptas standar · 4480 kms
Al encenderla empieza avibrar leve, andando no vibra ni en carretera, la corrí a 140 km/h y parada también vibra, según la agencia dijo que eran los buzos y 4 veces ingresó a la agencia y no le quitaron la falla, sigue igual ya no pienso llevarla, los demandare en Profeco para que me la cambien o me regresen mi dinero. Alguien tuvo la misma falla? Que fue lo que le arreglaron, gracias.
CH
ChimaMéxico
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Aun no me la arreglan sigue igual, la escanearon y no presenta el escáner ninguna falla.
hace un mes
Mejor solución  (según Chima, el autor del problema) 
Hola. Tengo el mismo problema, vibra cuando esta parada, ya revisaron las bobinas, bujías, inyectores,cuerpo de aceleración, válvula y manguera pcv y aun persiste. El escaneo no reporta ninguna falla. Necesito ayuda por favor. Gracias
hace un mes
Mejor solución  (según Chima, el autor del problema) 
Solucionado
 Ford Ecosport  2015 · SE 1.6 Nafta · 47000 kms
Gracias por la aceptación. Vivo en zona limítrofe y en Argentina uso en los servicios Elaion sintético cada 15000 km como aconseja el manual de mantenimiento. Averigüé en Uruguay y en los servicios (son agentes oficiales Ford) usan Texaco semi sintético cada 10000 km.
¿eso me podría acarrear algún inconveniente a futuro? gracias.
TO
TonyArgentina
hace 2 meses
Respuestas de la comunidad
Los mejores aceites atomotrices son sinteticos. Mientras sea una marca certificada por la marca automotriz no hay problema mas que realizar los cambios , mas frecuentemente. El aceite mineral se cambia cada 5,000 KM. el semi-sintetico cada 10,000 KM. y el sintetico cada 15,000 KM.
hace 2 meses
Mejor solución  (según Tony, el autor del problema) 
Gracias Ricardo. Muy clara tu respuesta.
hace 2 meses
Mejor solución  (según Tony, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 4 puertas, motor 2.0 · 178000 kms
Todo empezò en la autopista. Iba a 80 km/h se reventò la manguera inferior que llega al radiador. Nunca antes habia recalentado. Esperè a que se enfriara y la lleve remolcada a un estacionamiento. Se le cambiò la manguera. Salì de nuevo y en el mismo recorrido se prende el bombillo rojo de recalentamiento de la consola y la apaguè de nuevo: El agua en el embase estaba en ebulliciòn y se dañò el envase plàstico. Comprè uno nuevo con tapa independiente: Volviò a recalentar, la llevè al taller y el mecànico le cambiò la bomba de agua. Siguiò recalentando, se le cambiò el termostato y todavìa reca…Leer completa
JO
Josè LuisVenezuela
hace 2 meses
y otras 7 personas con el mismo problema
Respuestas de la comunidad
A mi me paso algo similar, cuando el radiador se queda sin agua, se llena de aire (evidentemente) por lo que cuando se llena nuevamente tienes que sangrarlo (quitar el aire del sistema), lo que deberia quitar el problema...
hace 2 meses
Mejor solución  (según Josè Luis, el autor del problema) 
El agua empieza a hervir del hemvase plastico. Ya camvie binba de agua y empaquetadura de culTa. Y sigue igual. Que puede ser
hace 2 meses
Mejor solución  (según Josè Luis, el autor del problema) 
Tengo un un ecosport del 2005 me paso lo mismo ya cambie el empaque de la culata y los retenes y aun sigue persistiendo el recalentado el mecánico menciona que se cambie la bomba de agua ya que el radiador esta complemente frió, Cual podría ser la solución.
hace 2 meses
Mejor solución  (según Josè Luis, el autor del problema) 
Tengo el mismo problema ya he cambiado todo saque la tapa y le hice la prueba hidraulica sigue calentando aparentemente no abre el termostato prende el electro el tacho hierve tira el agua
hace un mes
Mejor solución  (según Josè Luis, el autor del problema) 
Prueba las libras de la tapa y la parte eléctrica del bulbo, si no está en corto, relay y purgar el circuito por agun lugar profesional o alguien que haga eso
hace un mes
Mejor solución  (según Josè Luis, el autor del problema) 
Hoy mi eco levanto temperatura mire y el tacho estaba vacío, por alguna manguera pierde mañana me tiro debajo haber que es. Pero hay que purgar profesionalmente me dijo un mecánico amigo
hace un mes
Mejor solución  (según Josè Luis, el autor del problema) 
Amigos les comento que con respecto al recalentamiento de la Ecosport 2007, he tenido la siguiente experiencia que comparto con uds. luego de gastar un realero en envase plàstico, tapa con sello hidràulico, manguera inferior del radiador, bomba de agua y termostato, no he podido usar la camioneta por temor a que recaliente en una cola y pueda que pierda la inversiòn que he realizado. En las noches; al momento que no hay colas, la ruedo por pocas cuadras para que no se descargue la baterìa nueva y el problema sea mayor. He observado que poco a poco ha dejado de calentar, cada vez ruedo por tramos mas largos y a mayor velocidad y la aguja se mantiene en normal. Tengo pendiente como siguiente trabajo, limpiar y expurgar el radiador, ademàs hacer el mantenimiento del
Electroventicador. De no resolver el problema me toca cambiar la empacadura del tapa valvulas y la cadena del tiempo del motor. Vamos a ver. Sigo informando sobre resultados. Saludos y suerte para todos.
hace un mes
Mejor solución  (según Josè Luis, el autor del problema) 
Hola amigos también me pasa lo mismo ya cambien el termostato y la tapa de la bomba y sigue aun me falta ver la culata pero algua otra sugerencia?
hace un mes
Mejor solución  (según Josè Luis, el autor del problema) 
Hola pregunto si debe circular liquido refrigerante por la manguera fina que va conectada a la parte de arriba del deposito de refrigerante en la eco esport 2006
hace un mes
EdgartClaro que si, esa es la manguera de retorno del refrigerante.
hace 14 días
Mejor solución  (según Josè Luis, el autor del problema) 
Mejor solución  (según Josè Luis, el autor del problema) 
Buen dia jose luis. Logro resolver el problema del recalentamiento de su eco sport?
hace un mes
Mejor solución  (según Josè Luis, el autor del problema) 
El recalentamiento aparentemente se le quitò. Me trasladè un dìa normal a Los Palos Grandes ida y vuelta y pasò la prueba. No recalentò. Ojalà y continùe asì, a pesar de que no la he forzado mucho. Ha mejorado sustancialmente, desde que le puse el termostato nuevo. Saludos.
hace 25 días
Mejor solución  (según Josè Luis, el autor del problema) 
Tengo una ecosport 2012 empezo a levantar temperatura, enciende el electro, agua esta normal, cual puede ser el problema?
hace 24 días
Mejor solución  (según Josè Luis, el autor del problema) 
-1
Opcion 1: Termostato. Opcion 2: Bomba de Agua
Opciòn 3: Fuga de agua por manqueras, envase, conexiones. No inventes amigo. Llèvala a un taller de confianza y dile que le coloquen el Scanner, para dictaminar el problema especìfico, sin inventar. Saludos y Suerte. Revìsala cuanto antes. Cuida el motor, es lo màs importante.
hace 24 días
Mejor solución  (según Josè Luis, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · 110000 kms
Se prende la luz de check y no puedo verificar como se checa o se hacen pruebas de circuito
MO
moassaintMéxico
hace 2 meses
Respuestas de la comunidad
Llevalo a un autozne a escanerlo, es sin costo
hace 2 meses
Mejor solución  (según moassaint, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 32000 kms
Hola...apareció un fuete reguero de refrigerante en el piso, el recipiente está bien. Haciendo seguimiento por lo mojado es por parte derecha del motor.
JF
JfmedantColombia
hace 2 meses
Respuestas de la comunidad
Revisa si alguan de las mangueras de la caja del termostato esta rota o tiene fuga la caja que es de plastico y ya no esta sellando.
hace 2 meses
Mejor solución  (según Jfmedant, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 169452 kms
Alguien me puede decir que puedo hacer desarme la bomba inyectora i nada limpie el comanrrai i nada
AR
ArielArgentina
hace 2 meses
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2007 · 125000 kms
Motivado que mi eco se presentaba falla y se apagaba luego de recorrer trayectos durante dos o tres horas , me indicaron que era el catalizador , razón por la cual lo eliminaron y colocaron un bombona como reemplazo. La falla continuo.
Posteriormente se determino que la falla era generada por exceso de sucio en filtro interno que tiene la bomba de gasolina. Mi eco no fallo más , pero la luz permanece encendida. Se resetea y vuelva a prender. Si alguien que hacer para apagarla y que no se prenda nuevamente por falta del catalizador, agradezco indicarlo.
SI
siervoVenezuela
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Al eliminar el catalizador ya no tiene el sensor de oxigeno que mide los gases contaminantes del motor ,al no recibir esa señal ,la computadora prende el check engine. Para que se apague hay que instalarle un nuevo catalizador y sensor de oxigeno nuevos.
hace 2 meses
Mejor solución  (según siervo, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 2.0 Automatica · 194000 kms
Hablemos del catalizador... de la EcoSport 2007
Es cierto que al taparse, este puede ocasionar un daño irreparable al motor?
Es cierto que lo mas recomendable es sustituirlo por un resonador?
Es cierto que a veces, al sustituirlo se presentan problemas que antes no se tenían?
Que problemas puede generar un catalizador dañado o tapado?
Cual es su tiempo de vida?
ED
EduardoVenezuela
hace 2 meses
Respuestas de la comunidad
El catalizador se tapa por usar aceites y combustibles de baja calidad y mal funcionamiento del motor, cuando empieza a fallar se pierde potencia , aumenta el consumo de combustible ,incluso llega a quedar al rojo vivo al calentarse. Pero antes de eso la computadora ya lo detecto y te avisa con el check engine. El sustituirlo por otro tipo no es recomendable ya que en el lleva el sensor de oxigeno que mide la emision de gases contaminantes. Un catalizador con el 95 % de eficiencia ya lo detecta la computadora y prende el check engine ,se puede seguir usando el vehiculo pero mantendra la alerta encendida siempre.
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Gracias, pero... si entendí bien entonces NO TIENE SOLUCIÓN? por que si no se puede sustituir... entonces se deja, aun teniendo fallas? que tiempo de vida promedio tiene? tomando en cuenta que el mantenimiento regular se ha llevado a cabo normalmente... Gracias
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Si se puede sustituir ,por uno nuevo. Es lo recomendable , con ese kilometraje recorrido ya termino su vida util.
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Tengo una eco sport 2011 se me avia soplado la junta y de ahi q la repararon anduvo poco meses bien. Empezó a ponerse al rojo vivo bajo del sonda lambda , lo cambié anduvo. Igual , me isieron vaciar el catalizador anda Igual le cambió el RPM y todo sigue igual. No se q mas hacerle.
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Nilda, pero le haz puesto el scanner? si vives en Argentina me imagino que tienes acceso a talleres Ford autorizados y a repuestos originales, al ponerle el scarner de un taller autorizado Ford debería indicarte que realmente esta dañado.
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Nilda, deberías hacer que revisen bien la admisión del motor ya que si presenta alguna fisura que es común en este vehículo por sacarla la rompen, y cambiar bien todos los sellos de goma, esa falla puede ser por la entrada excesiva de oxigeno al cilindro.
hace 2 meses
Mejor solución  (según Eduardo, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · 34000 kms
La camioneta semanalmente me esta consumiendo un cuarto de aceite por lo cual, la lleve al concesionario FORD en la ciudad de Bucaramanga - Departamento de Santander Pais Colombia, y luego de cobrar un monto de dinero por revizarla y cuatro dias alli me informan que la compresion esta fallado y las bujias estan mojadas de aceite y se debe desmontar el motor para lo cual me cobran un dineral, la garantia era de 3 años a 100.000 kilometros y se cumplieron en el mes de mayo de 2016, por lo cual FORD no responde por el daño en un motor nuevo sin terne siquiera la mitad del kilometraje de la garantia,
NA
NAN071Colombia
hace 2 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
-2
Son defectos de fabrica ford , por usar autopartes de baja calidad
hace 2 meses
Mejor solución  (según NAN071, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · automatica 2.0 · 134000 kms
Cuando voy corriendo despues de un rato se recalienta pero parada encendida no recalienta
JO
jose30Venezuela
hace 2 meses
Respuestas de la comunidad
Revisa la bomba de agua , si es la original de fabrica , hay que cambiarla.
hace 2 meses
Mejor solución  (según jose30, el autor del problema) 
Solucionado
 Ford Ecosport  2006 · 120000 kms
Ami también me pasó eso la semana pasada, iba en carretera y de repente perdió fuerza de 80km bajó hasta 40km y jaloneos prendida y parada estaba bien aceleraba y solo subía a 3mil revoluciones y bajaba, parte de lo q le hice fue cambiar los cables de bujías ya q un cable si estaba mal pero siguió la falla me dijeron q era la bomba de gasolina y seguía sensor tps o algo así y siguió igual filtro de gasolina tmb y nada disque una manguera q agarraba aire tampoco y lo último q le hice fue quitar el catalizador y así fue como quedo la camioneta tenía tapado el catalizador ojalá ayude en algo saludos
MA
Mario TMéxico
hace 2 meses
y otras 2 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2006 · 1.6 xl plus · 162500 kms
En primera cuando sale se escucha un ruido metalico que raspa, o cuando vas despasio en segunda marcha y frenas para pasar un vaden o loma de burro cuando aceleras nuevamente se escucha el ruido... y me pierde aceite de transmision por el reten del semieje ya se lo cambie pero me sigue perdiendo aceite. Le cambie el taco motor de la caja, le cambie el aceite de transmision y le cambie la trizeta pensando que podia ser eso pero el ruido todavia sigue. Tambien pense que podia ser el bolillero de la rueda pero no se mueve la rueda...
JO
jorgeArgentina
hace 2 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Amigo tienes in rodamiento interno de la caja de cambios malo, ve a que ye desarmen la caja y lo cambien antes de que se rompa y dentro de la caja y haga un desastre
hace 14 días
Mejor solución  (según jorge, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 4 puertas, motor duratec 2.0 · 169000 kms
Tengo una Eco año 2017, motor 2.0, mi problema es que se me reventó la manguera triple que va desde el envase de agua, conecta a la calefacción y sigue al termostato, la pregunta es ¿puedo condenar la calefacción taponeando la manguera que conecta a la calefacción (la cual se rompió) y taponeando la toma de agua que está debajo de la bóbina y sigue al radiador?
HE
HernanHHVVenezuela
hace 2 meses
y otras 3 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2005 · 4 puertas, año 2005, 1,6 · 142000 kms
Le cambie la bobina a mi Ford ecosport y ahora lo enciendo y sale mucho humo blanco por el escape y un olor como a carburo o catalitico, además el motor como en baja tiene como una baja de Potencia y baja la aguja de las revoluciones, necesito ayuda X favor alguien me pueda ayudar con mi duda
SI
SimonChile
hace 2 meses
Respuestas de la comunidad
Puede ser que la bobina es generica y no manda la suficiente corriente para realizar la combustion correctamente y pasa la gasolina cruda al escape. Consigue una original MOTORCRAFT
hace 2 meses
Mejor solución  (según Simon, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · 23300 kms
Alguien puede ayudarme compré una Eco Sport 2013 la sencilla de 1.6 y anteriormente cambie la batería motorcraf original de fábrica x una bosch por lo q presentaba apagado de auto frenos abs se bloquearon etc x eso cambie de batería resulta q después de 7 meses de un momento a otro la radio se desconfiguro encendía pero no funcionaba lleve al taller y desconectaron la batería y luego la conectaron y volvió a configurarse la radio pero mi co sulta es q batería exactamente le debe hacer a este tipo de auto la q compre fue bosch S545D 12 y de 330 amp. Por Favor su ayuda... gracias
JE
JennyPerú
hace 2 meses
y otras 2 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2012 · ecosport · 137000 kms
Hola Amigos, tengo un problema me arranca en 3 cilindro, la paro le doy arranque devuelta y arranca bien, eso me pasa cuando al arrancarla en frío. Es una XLS modelo 2012 con motor 2.0. Antes la tuve con equipo de gas y me hacía lo mismo, se lo saqué y sigue igual que podrá hacer los mecánicos me dicen que tiene que ser la computadora pero la revisaron y no le encuentran nada.
PE
peladoArgentina
hace 2 meses
Respuestas de la comunidad
Revisa el sensor del arbol de levas esta presentando falla intermitente , no tarda en dejar de arrancar.
hace 2 meses
Mejor solución  (según pelado, el autor del problema) 
Hola Ricardo mira arranca enseguida, y en el primer arranque sabe fallar le saco el contacto y la vuelvo a encender y no tiene la falla y ando con la luz amarilla prendida.
hace 2 meses
Mejor solución  (según pelado, el autor del problema) 
Hay que escanearla para ver que codigo de falla presenta, en tu pais hay tiendas de refacciones AUTOZONE ? SI ES AFIRMATIVO ,AHI ESCANEAN EL MOTOR SIN COSTO.
hace 2 meses
Mejor solución  (según pelado, el autor del problema) 
Solucionado
 Ford Ecosport  2012 · ecosport · 137000 kms
Hola Amigos, tengo un problema me arranca en 3 cilindro, la paro le doy arranque devuelta y arranca bien, eso me pasa cuando al arrancarla en frío. Es una XLS modelo 2012 con motor 2.0. Antes la tuve con equipo de gas y me hacía lo mismo, se lo saqué y sigue igual que podrá hacer los mecánicos me dicen que tiene que ser la computadora pero la revisaron y no le encuentran nada.
PE
peladoArgentina
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Hola a mi me pasaba lo mismo y lo solucione se me quemo un de los 4 pulsos de la computadora y lo puentiaron y anda joya lo que tengo que ver si puedo encontrar otra computadora por si algun dia no anda mas
hace un mes
Mejor solución  (según pelado, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 52500 kms
Se enciende el cheeck del tablero titila y luego queda fijo, luego de revisar noto que empasta la bujía del segundo cilindro, tiene 52500 km, me dice el mecanico que hay que cambiar aros que es una falla de fabrica algo que me parece muy raro por la poca cantidad de km la tengo de 0 km
CL
claudioArgentina
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Que le mida compresion a ese cilindro para verificar su teoria.
hace 2 meses
Mejor solución  (según claudio, el autor del problema) 
Solucionado
 Ford Ecosport  2010 · 128 kms
Quiero q alguien me diga sobre mi escoesport ultimamente cuando en ciudad y vajo la velocidad el cuenta vueltas q tiene q quedar en 1000 revoluciones se me baja a 500 o menos y se para aveces lo hace y aveces no alguien me podra esplicar q puede ser muchas gracias
MA
martinArgentina
hace 2 meses
Respuestas de la comunidad
Revisa la valvula iac (valvula de aceleracion minima) es la que regula el ralenti (rpm ) del motor para que no se apague, esta oculta detras del multiple de escape, se lava con limpiador de carburador en spray , si no mejora hay que cambiarla por otra original.
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Solucionado
 Ford Ecosport  2013 · New, cinco puertas, bencinero, 1.6 · 70000 kms
En tres ocasiones me ha ocurrido lo mismo y aún no saben qué es, cuando voy viajando y está lloviendo aparece el mensaje de "motor averiado diríjase a servicio técnico de inmediato", el motor se detiene y no vuelve a encender, he tenido que ser trasladado por grúa las tres veces. En taller sólo me dan diagnósticos informales.
YO
Yovanny ManzoChile
hace 2 meses
Respuestas de la comunidad
Revisa el sensor de cigueñal. Puede estar fisurado y al mojarse apaga el motor.
hace 2 meses
Mejor solución  (según Yovanny Manzo, el autor del problema) 
Solucionado
 Ford Ecosport  2010 · 100000 kms
No arranca con la llave original probé con la alternativa y no tuve problemas. La lleve a un cerrajero del automotor y me dijo que era el chip de la llave. Puede ser? Como puedo hacer para que funcione mis 2 llaves?
NO
NoeWArgentina
hace 2 meses
Respuestas de la comunidad
Ve si se puede reprogramar el chip con el cerrajero automotriz, de lo contrario que te haga otra y la programe.
hace 2 meses
Mejor solución  (según NoeW, el autor del problema) 
Ve si se puede reprogramar el chip con el cerrajero automotriz, de lo contrario que te haga otra y la programe.
hace 2 meses
Mejor solución  (según NoeW, el autor del problema) 
Ve si se puede reprogramar el chip con el cerrajero automotriz, de lo contrario que te haga otra y la programe.
hace 2 meses
Mejor solución  (según NoeW, el autor del problema) 
Solucionado
 Ford Ecosport  2015 · 15000 kms
Mi camioneta es una ecosport 2015 de 4 cilindros motor 2.0 en un transcurso de 40 kilometros de distancia a una velocidad de 100 a 115km/h me gasta alrededor de medio tanque de combustible. Yo no creo que sea algo normal por el kilometraje y el año. Se me hace que gasta mucha. Espero y alguien pueda darme una respuesta a este problema.
ES
escorpioMéxico
hace 2 meses
Todavía no hay respuestas  ¿Por qué?
Solucionado
 Ford Ecosport  2007 · 111000 kms
Buenos días, tengo un problema con las alarmas del tablero , se prenden al mismo tiempo, la alarma de la temperatura, el motor y el sistema antirobo parpadea, pero se apagan despues de unos segundos, eso se presenta constantemente. Que me suguieren. Cheque fusibles y uno de los principales, (el numero 12, del encendido, esta muy caliente), creen que eso sea el motivo o es otro problema
AL
AlvaMéxico
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Llevala a un centro de servicio lth a diagnostico electronico es sin costo. Puede ser que la bateria este dañada , en caso contrario seria un defecto electrico del vehiculo.
hace 2 meses
Mejor solución  (según Alva, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 4 · 144000 kms
Mi consulta es si el ford ecosport 2005, tiene sensor de neutro. Ademas consultó X que transitaba en mi Ford y al llegar a un subida como que se chupo y le faltó fuerza al motor y al llegar a carretera plana siguió igual y como que sale un humo más negro X el escape. Q podrá ser si alguien me puede ayudar X favor
SI
SimonChile
hace 2 meses
Respuestas de la comunidad
Desconecta el sensor de oxigeno , si mejora lo cambias.
hace 2 meses
MatyDonde se encuentra el sensor de oxígeno en la rco eco sport 2003 ?
hace 12 días
Mejor solución  (según Simon, el autor del problema) 
Mejor solución  (según Simon, el autor del problema) 
Sensor de oxigeno 1 en el multiple de escape del motor. Sensor de oxigeno 2 despues del catalizador ,antes del silenciador de escape ,abajo del vehiculo
hace 12 días
Mejor solución  (según Simon, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 4 puertas full 1.4 turbo diesel · 166000 kms
Hola tengo una duda a ver si alguno me saca de esa duda...tengo la eco 1.4 turbo diesel.me cuesta q arranque a la mañana y fijandome la luz de la resistencia q tendria q prender en el tablero no prende...seria ese el motivo de q le cueste arrancar a la amñana...despues anda de diez...gracias
MA
martinArgentina
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Revisa si tenes tension de corriente en los calentadores en el momento de dar contacto. ,de ser asi volve a consultar
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Hola ova55 eso voy a ver ya cuando lo haga el control y comento como me fue. Gracias...
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Ok saludos espero poder ayudado
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Ova55 eso lo puedi medir yo mismo...perdon x mi ignorancia...y como lo hago. Gracias
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Hola si si tienes un probador tipo punta de prueba 12 v ,deberas de desconectar el cable que alimenta al cantador , la punta en el cable de alimentac
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Y el otro extremo a masa , si no te sentis seguro hace con un electricista del automóvil es sencillo
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Ah bueno dale gracias ova55 te agradezco mucho la ayuda...lo voy a revisar y lo comento...gracias
hace 2 meses
Mejor solución  (según martin, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · Motor 1,6 naftera con GNC · 220 kms
Tuve problemas con mi camioneta...venia circulando y de repente c paraba el motor y volvia a arrancar, llegue a casa y cuando quise darle arranque me figuraba un dibujo de la camioneta con un candado...al cabo de unos dias y sin poderla encender me dijo un electrisita q le habia caido acido de la bateria al ramal del arranque...podra ser tan asi? La computadora de la camioneta no se arruino pero sigue con el problema...cuanto me puede llegar a salir ese tipo de arreglo y si tiene solucion
PA
PABLOArgentina
hace 2 meses
Respuestas de la comunidad
Es el inmovilizador (candado) puede ser que no esta identificando el chip de la llave , prueba con el duplicado.
hace 2 meses
Mejor solución  (según PABLO, el autor del problema) 
Solucionado
 Ford Ecosport  2014 · automatica titanium 4*2 power shif · 51 kms
Buena tarde hace unos días se predio la luz del check engine, al revisar el vehiculo no me funciona la reversa ni la secuencial. La lleve al mecanico y encuentran un codigo de error 90 que al paracer es una baja tension en la caja. Revisaron el TCM y le cambiaron un condensador pero sigue el mismo problema.
Quedo atento a sus cometarios
NE
nelgomColombia
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Llevala al distribuidor FORD , por muchos defectos de fabrica ampliaron a 10 años la GARANTIA de esas transmisiones automaticas
hace 2 meses
Mejor solución  (según nelgom, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · 4 · 1444000 kms
Conducía por una ruta y al ingresar a una subida el auto comenzó a tirones el motor, o como q se chupo el motor y siguió así Hasta ahora que podrá ser, le agradezco su respuesta
SI
SimonChile
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Revisa la bomba de gasolina , puede haber perdido presion
hace 2 meses
Mejor solución  (según Simon, el autor del problema) 
Solucionado
 Ford Ecosport  2010 · 28599 kms
Amigos realice afinación a mi ecosport , cambie aceite y bujías para llevarla a verificar , pero me dijeron que lavara el cuerpo de aceleración así que desmonte mariposa y válvula IAC , arme y encendí el motor pero al acelerar como que se ahoga y vibra el motor, antes de esto funcionaba bien
CH
ChenMéxico
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Se desconfiguro el cuerpo de aceleracion.
hace 2 meses
Mejor solución  (según Chen, el autor del problema) 
Hola Ricardo
Me puedes decir como configurarlo nuevamente.
hace 2 meses
Mejor solución  (según Chen, el autor del problema) 
Al lavar el cuerpo de aceleracion se movio la mariposa, esta a su vez la calibracion del sensor tps que regula electronicamente la aceleracion del motor , para configurarlo nuevamente tienes que llevarlo a un taller para que con un escaner especial o una computadora con el programa se pueda reconfigurar de nuevo.
hace 2 meses
Mejor solución  (según Chen, el autor del problema) 
Gracias Ricardo
No es posible que se recofigure automaticamente con algun Metodo, ya que es comun lavar el cuerpo de aceleracion, tu que opinas
hace 2 meses
Mejor solución  (según Chen, el autor del problema) 
Si es comun lavar el cuerpo de aceleracion , pero hay su tecnica y procedimiento para no desconfigurarlo. Entra a youtube hay videos al respecto
hace 2 meses
Mejor solución  (según Chen, el autor del problema) 
Agradezco tu ayuda Ricardo, la voy a llevar a un taller. Gracias
hace 2 meses
Mejor solución  (según Chen, el autor del problema) 
Solucionado
 Ford Ecosport  2007 · 84500 kms
No ha manifestado ninguna falla que haya podido detectar aun.
YA
Yamina SosaVenezuela
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
A mi me ocurre lo mismo la luz testigo del motor se enciende dura así uno o dos días, y después se apaga, sin presentar ninguna falla. A veces creo que es la calidad del combustible. De alguna manera esto ocurre cuando se tiene menos de un cuarto de tanque. Recién cambie batería porque saco la mano la que tenia, lo raro es que el testigo de batería nunca reporto falla voy a mirar si eso soluciono lo otro, si en quince días no enciende esa luz de falla te cuento. Por ahora estamos en tarea de investigar de que se trata.
hace 2 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Se me olvido comentarte la mia es una Ecosport 2011
hace 2 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Hola Eugenio, gracias por tu comentario, revise un poco y solo observé que los bordes de la batería estaban sulfatados, los limpié y supongo que al desconectar los bornes se reseteó la computadora y la luz no volvió a aparecer. La mia es una Eco Sport 2.007 Automática. Saludos.
hace 2 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Hola Yamina no me volvió a encender la luz de motor de manera que si esta relacionado con la batería veo que a ti también se te soluciono por la misma causa, los bornes sulfatados hacen que el voltaje baje por mal contacto en mi caso tenia una celda dañada la batería menos mal no me varé porque mi caja también es automática. De todas maneras cargo el cable para emergencias, (te lo recomiendo uno nunca sabe) siento una gran felicidad porque compartimos y solucionamos el problema.
hace 2 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Solucionado
 Ford Ecosport  2005 · xlplus 1.6 · 200 kms
Cuando descubro la rotura en el recipiente lo arreglo provisoriamente para seguir viaje, y la temperatura variaba de cero a mitad de la misma , y de ahi se venia a 0 y se aceleraba sola. Y a su vez fallaba , cuando moderaba se detenia el motor, que podra ser? espero su respuesta
PI
piturroArgentina
hace 3 meses
Respuestas de la comunidad
El sistema de enfriamiento es sellado , al haber una fuga permite aire al sistema y ocasiona fallas como las que mencionas.
hace 3 meses
Mejor solución  (según piturro, el autor del problema) 
Cambie el receptorio y me hace la misma falla pregunto no sera el bulbo
hace 3 meses
Mejor solución  (según piturro, el autor del problema) 
Se purgo el sistema de enfriamiento despues de cambiar el deposito ? si tiene aire ,seguira igual.
hace 3 meses
Mejor solución  (según piturro, el autor del problema) 
Desde donde se purga?
hace 3 meses
Mejor solución  (según piturro, el autor del problema) 
Con el motor frio, se destapa el radiador o el deposito de retorno, enciende el motor, aceleralo moderadamente para que recircule el anticongelante en todo el sistema y elimine el aire que pueda tener.
hace 3 meses
Mejor solución  (según piturro, el autor del problema) 
Tienes que acerle cambiar la válvula del reostato ya que esta es la que controla la temperatura del motor , por eso te rompe el tanque de plastico ya que la presion del refirgerante aumenta
hace 2 meses
Mejor solución  (según piturro, el autor del problema) 
Solucionado
 Ford Ecosport  2008 · 4 puertas, motor 2.0 , standard . · 105000 kms
Que tal!! Soy primerizo por aquí, aunque ya en ocasiones me he ilustrado con sus aportaciones. Mi problema es el siguiente... La camioneta comenzó a sentirse "sin fuerza" , hasta que un día se apagó cuando hacia el cambio a reversa para estacionarme (en una hora y media que enfrió, la pude prender) ...ese mismo día más tarde, se me apagó cuando cambiaba a 2a. Pasando un tope (enfríe la bobina con una franela húmeda y arranco... Y cambie la bobina) ...dos días después se apagó justo cuando pongo neutral al estacionarme (no funciono enfriar la bobina... Ahora saque y limpie el sensor de árbol d…Leer completa
CH
ChecoMéxico
hace 3 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Hola buen dia!tengo una ecoesport 2.0 16 valvulas.no le puedo encontrar la falla,la camioneta en frio funciona perfecto pero despues de circular un rato se para y al tratar de encenderla cuesta 3 o 4 veces de arranque en prender anda bien otro rato y vuelve a hacer lo mismo-
Yo pense que era la bobina de encendido que se recalentaba y se ponia en corto,pero la cambie y me siguio haciendo lo mismo.me podran asesorar por favor para poder encontrar la falla porque ya me bloquee. Gracias
hace 2 meses
Mejor solución  (según Checo, el autor del problema) 
Hola tendo una eco 2010 /1.6 zetex y algo parecido por la ruta se agotaba como que se quedaba sin gas o se tapaba la alimentacion me resultaba esperar unos minutos asta que era inutil después se me ocurrio levantar el capot y jugar con los canitos de aire que estan por ahi arriba los desconectada en el motor en ralenti los tapaba con el dedo dos o tres veces lo conectaba otra vez y era como la epinaca para popeye asi logre llegar a destino en 300 km me iso dos o tres veces lo de perder furza en alta pero en ralenti nediana mente bien... En la ruta todo bien pero en el trancito cuando te pasa es un parto en la computadora de tes marca sensor de posicion leva. Porque prende la fomosa luz de falla pero... bueno made lavar el motor y desaparecio el problema no asi la luz del tablero auque cambie el sensor es ahi donde esta mi problema anda todo bien pero no apaga la luz de averia del. Sensor que mencione ??
hace un mes
Mejor solución  (según Checo, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 100000 kms
Viajando se encendió la luz testigo de advertencia del motor, no acusa problemas en la marcha del motor.
IN
IndioArgentina
hace 3 meses
Respuestas de la comunidad
Puede ser que este bajo el voltaje de la bateria ,revisa si estan firmes las terminales o sulfatadas. Si las luces estan debiles y amaillentas, los wipers van lentos , si tiene mas de año y medio de uso , es la bateria
hace 3 meses
Mejor solución  (según Indio, el autor del problema) 
Solucionado
 Ford Ecosport  2014 · 30850 kms
Buenas tardes a los 30800 no entraba la reversa y estaba prendido el foco de check engine lo lleve a la agencia me dijero que era el módulo TCM se lo reemplazaron junto con un engrane tan solo transite 30 km y me marca lo mismo solo que transmisión averiada servicio inmediato, lo vuelvo a llevar a la agencia y me comentaron que era la batería el carro si encendio en su momento lo tránsito 5 km y lo apago al encenderlo marca lo mismo pero solo que no camina en ningún cambio cree que podría ser la batería ???
HU
Hugo982México
hace 3 meses
Respuestas de la comunidad
Puede ser que este bajo el voltaje de la bateria ,revisa si estan firmes las terminales o sulfatadas. Si las luces estan debiles y amaillentas, los wipers van lentos , si tiene mas de año y medio de uso , es la bateria
En las agencias ,saben que es un defecto de calidad de ford , le ponen baterias de 45 amps. Que superan el consumo de corriente por todo el equipamiento que traen de fabrica , hay que moenerle una bateria de 65 amps, y se soluciona.
hace 3 meses
Mejor solución  (según Hugo982, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 2.0 XLS · 78000 kms
Donde se encuentra la bomba en el exterior del motor o en el interior
NE
NESTRIArgentina
hace 3 meses
Respuestas de la comunidad
Es como la mayoria de las bombas de agua , dentro del motor esta el impelente de la bomba y en el exterior la polea que la mueve la correa del cigueñal.
hace 3 meses
Mejor solución  (según NESTRI, el autor del problema) 
Solucionado
 Ford Ecosport  2010 · xls 2.0 gnc · 100000 kms
Buenas, les comento mi caso. Hace un par de meses viajando mi Eco comenzo a fallar, me dejo a pata y la lleve a arreglar. Le cambiaron una bobina y todos las bujias. Un tiempo despues noto que no alcanzo a acelerar a la velocidad a la que podia antes, y luego de un viaje de 400 km noto que no tiene potencia en absoluto, no acelera a mas de 100 y tengo que bajar la marcha para levantar revoluciones. Por cierto las Rpm estan bajas, no la puedo pasar de 2000 y algo, lo que si se consigue sin problemas en punto muerto. Si alguien tiene una idea les agradezco me la compartan. Saludos!!!
JA
javivet79Argentina
hace 3 meses
Respuestas de la comunidad
Parece una falla típica de cuando se tiene corrido el tiempo de encendido, o la correa de del eje de levas esta estirada
hace 2 meses
Mejor solución  (según javivet79, el autor del problema) 
Buenas, gracias por la respuesta. Me y vio mi mecánico y me llamó diciendo que para el era el escape. Efectivamente, le sacaron el catalizador y ahora anda bárbaro la eco. Veré cual es el problema que derivó en esto, pero por ahora acelera perfecto. Saludos!
hace 2 meses
Mejor solución  (según javivet79, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 4 puertas full diesel 1.4 · 45000 kms
Prende a veces la luz de advertencia de motor, a veces parpadea, a veces fija y a veces ni prende. Lo unico q hice fue cambiarle la bateria, porque no queria arrancar a partir d ahi empezo a aparecer la luz, se escanio pero no sale error
GA
GabyArgentina
hace 3 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Debes asegurarte que la batería cumpla con las especificaciones de Amperaje minimos, si eso esta bien debes revisar que el generador este dando corriente suficiente para mantener la carga, y si todo esta bien tal vez se te olvido chequear que estuviera full carga la batería nueva
hace 2 meses
Mejor solución  (según Gaby, el autor del problema) 
Para la ecosport automática motor 2.0 debes usar una batería no inferior a 550 amperios
hace 2 meses
Mejor solución  (según Gaby, el autor del problema) 
Solucionado
 Ford Ecosport  2011 · 4 puertas full diesel 1.4 · 45000 kms
Prende a veces la luz de advertencia de motor, a veces parpadea, a veces fija y a veces ni prende. Lo unico q hice fue cambiarle la bateria, porque no queria arrancar a partir d ahi empezo a aparecer la luz, se escanio pero no sale error