Problemas de Motor del Ford Ecosport

Problemas por categoría

Problemas destacados (ver recientes)

 Ford Ecosport  2004 · 4 purtas · 120000 kms
Hola a todos, le hice motor completo a mi eco sport TDCI 1.4 tubo diesel, y resulta que cuando le dimos marcha, no quisi arrancar mas, segun el mecanico es una falla electronica, le lleve al tecnico y no puede solucionar xq no tiene el esquema electrico de la camioneta, para buscar la falla; si alguno sabe algo me puede dar informacion xq ya hace 1 año que no puedo ocupar mi chata, gracias
hace 2 años
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Hola. No puedo ayudarte con tu pregunta pero aprovecho y te hago una consulta pq también debo hacer el motor de mismo vehículo, modelo 2004. ¿Qué costo total manejaste? Gracias
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
Hola Dario, mira hasta el momento voy gastando en repuestos y mano de obra; $25000, y ahora surgio este problema q no se cuanto mas voy a gastar, espero que te sirva la informacion. Soy de corrientes, saludos
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
Si la trajeras al taller por 25000 te damos otra y te abanicamos, es una LOCURA!!!, un motor hecho a nuevo completo de esta chata e instalacion electrica con sensores incluidos no puede NUNCa superar los 9000... que se yo, se que no es de ayuda pero ese mecanico es un ladron, sacala de ahi y llevala a la ford o mandala a alguien responsable que te de un presupuesto ANTES de tocarla Saludos. Gastón / Tesla-Mecánica y Diagnóstico Computarizado Automotriz / Ramon Falcon 3666, San Justo / Tel: 1533783330 / nextel : 242*1094 /
hace 2 años
JavierHola gaston, te consulto, tengo una ecosport 2005 diesel, para colocarle un motor naftero, aprate del motor que mas se debe cambiar?
hace 23 días
Mejor solución  (según Diego10, el autor del problema) 
Mejor solución  (según Diego10, el autor del problema) 
Hola diego soy guille queria saber si resolviste tu problema porque ami me paso lo mismo
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
Hola Guillermo, no amigo, ya estoy cansado de tantas cosas que me dicen, pero consegui el manual eléctrico en Mercado Libre, lo que me pidió el técnico, así que estoy esperando que me llegue el manual, y se lo entrego al técnico, y de ahí, a esperar de nuevo. Saludos
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
La rectificadora me cobro con repuestos incluidos $15800, despues tuve q comprar a parte la bomba de aceite, correas, tensores, filtros, embrague placa y disco, xq ya estaba desgastado, y alguna que otra cosa mas y llega a los 25mil pesos.
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
Tengo el mismo problema y gaste casi el mismo numero ,mi camioneta es mod 2009 y nadie me la puede poner en marcha. Hoy la deje en otro taller , espero tener la solucion
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
Alguien que me pueda ayudar, diciendome donde la puedo llevar y que la dejen funcionando bien!!! Gracias...x favor donde la puedo llevar?
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
Hola tengo el mismo problema con mi eco, me recomiendan que no la rectifique, ya que es gastar y gastar, no consigo el motor por ningún lado, en cesvi auto no lo tienen, yo pregunto si se le puede colocar un motor 1.6 naftero, me dijeron que es lo mismo pero no se si es cierto. Le agradezco si me pueden comentar.
hace 2 años
Mejor solución  (según Diego10, el autor del problema) 
Hola yo también ya gaste los 25 mil y no arranca, la mía es 2.0 la han escaneado 4 veces distintos ing. Eléctricos y no dan,sigue sin arrancar dijerron que fue la computadora la repuse nueva, después sensor de cigüeñal y nada si alguien puede ayudarme lo agradezco de antemano.
hace un año
Mejor solución  (según Diego10, el autor del problema) 
Hola a todos, soy mecanico y ya solucione varios problemas de motores nuevos que no arrancan, todo se soluciona antes de cambiar algo hay que revisar la instalacion electrica completa el minimo error no te arranca
hace un año
Mejor solución  (según Diego10, el autor del problema) 
Hola amigo, de donde sis? Y donde tenes el taller? Pasame datos de tu empresa o taller. Espero tu respuesta
hace un año
Mejor solución  (según Diego10, el autor del problema) 
Hola diego10, estoy en moreno bs as, de donde sos vos, saludos
hace un año
Mejor solución  (según Diego10, el autor del problema) 
Soy de paso de los libres, corrientes.
Pasame nro de whatsapp si tenes
hace un año
Mejor solución  (según Diego10, el autor del problema) 

 Ford Ecosport  2013 · SE 1.6 N · 33600 kms
Me dejo tirado en el medio de una avenida sin aviso. Aparecio la leyenda direccion asistida averiada, abs averiado y me fue desconectando en segundos todos los sistemas, tablero, dirección electrica, hasta que llego a la parada del motor (desconecto bomba de nafta). Al querer arrancarla las agujas tintineaban como a los otros usuarios. (enero de 2015) Se le cambio la bateria por otra original y funcionó hasta ahora (mayo de 2015) cuando me hizo lo mismo en pleno libertador pero no detuvo el motor ahora lo que hizo fué deshabilitar el acelerador. Me dejo sin propulsión. Le cambié otra bateria y…Leer completa
hace 2 años
Respuestas de la comunidad
A mi me esta pasando exactamente lo mismo, el carro deja de funcionar de repente y las luces empiezan a titilar!
hace 2 años
Mejor solución  (según nachosac, el autor del problema) 
Estimados esta claro que el problema es la batería, es chica, no se banca la cantidad de cosas eléctricas que tiene esta versión a diferencia de la anterior, por lo que veo todas son camionetas nuevas, y todas estan en garantía, sugiero llamar al 0800-888-3673 de Atencion al cliente de Ford, atienden de lunes a viernes de 09:00 a 21:00 y comentarles este tema, las concesionarias nos sacan cagando y este problema no llega arriba, yo tengo que llamar por la campaña de las puertas y se los voy a decir y les voy a preguntar si tienen reporte de esto. Tengo la carta de la campaña a la vista pero no hay ningún mail, les voy a preguntar si tienen uno, para ver si se puede hacer por mail, muchas veces uno se puede explayar mejor en una nota que hablando por teléfono, seguramente ellos van a estar muy interesados de saber que hay mucha gente disconforme con esto, pero si no protestamos, nos calentamos nosotros, las concesioanarias no saltan y en la fabrica nadie se entera.
hace un año
Mejor solución  (según nachosac, el autor del problema) 
Tengo una eco 2014 y sufro los mismos problemas eléctricos que ustedes lo que no se es la campañas de las puertas ???? que problema tienen
hace un año
Mejor solución  (según nachosac, el autor del problema) 
Finalmente en la mia no era la bateria sino un cable semiseccionado en el torpedo del maquina que aprisionaba el mazo de cables por una falla en la fabricación provoco un estrangulamiento mayor que provocaba esta falla al detectar la computadora un corto y ponerse en modo autoproteccion, me lo solucionaron sin cargo en SAUMA de san fernando(estaba en garantia y tienen al mejor electricista de Ford incluso premiado)
hace un año
Mejor solución  (según nachosac, el autor del problema) 
 Ford Ecosport  2005 · 4x2 nafta 1,6 · 130000 kms
Ya se cambio el electro y relay que posee resistencia y el problema perciste desde le agradeceria si pudieran ayudarme
hace 3 años
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Probablemente sea el sensor de temperatura (está a la derecha del motor sobre la pieza que distribuye el agua y que tiene el termostato). Cuando la indicación del sensor está fuera de los límites ya sea maximo o mínimo, la computadora considera que está fallando y prende el electro al máximo por las dudas.
hace 3 años
Mejor solución  (según carlos, el autor del problema) 
Ok muchas gracias ,voy a remplazar y despues les cuento
hace 3 años
Mejor solución  (según carlos, el autor del problema) 
Hola pudistes solucionarlo. Tengo el mismo problema!!
hace un mes
Mejor solución  (según carlos, el autor del problema) 
 Ford Ecosport  2011 · 4 puertas  · 80000 kms
Se prende en el tablero el anuncio de falla de motor (motorcito amarillo) y no falla nada. Me han cambiado la bomba del agua, un chip, "arreglado el radiador", mil cosas más y sigue prendido. Realmente no falla nada del carro, pero quiero venderlo y desearía que se apagara ese fóquito amarillo
hace 2 años
Respuestas de la comunidad
Para detectar lo que manda prender ese foquito necesitas escanearlo.
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
Buenas tarde patricia, mira yo tuve un problema similar con mi camioneta, me escanearon mi camioneta y arrojo dos códigos que no recuerdo el numero, pero eran relacionados con las bujías y e inyectores; el mecánico me dijo que se borrarían los códigos si en realidad eran esa fallas ya que le hizo la afinación, pero desgraciadamente no se borro el símbolo del motor seguía encendido, por lo que el mecánico me aconsejo que lo llevara a escanear para que le borraran los códigos y quedara lista. Recordé que leyendo en internet algunas personas habían borrado los códigos desconectando la batería del carro por espacio de una hora y fue lo que hice y asunto arreglado, nunca mas he tenido ese problema desde hace 8 meses, Saludos.
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
Gracias por responder, como ya lo escanearon y le arreglaron varias cosas y sigue prendido, me parece excelente la propuesta de LexUAG, hoy mismo desconecto la batería y sería maravilloso si resulta eso tan sencillo para mi camioneta. Muchas gracias y los tengo informados. Patriciaq
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
Hola Patricia!! Te funcionó el desconectar la batería? Tengo el mosmo problema que tu con ese motorcito amarillo que no se apaga y ya han revisado mi camioneta muchas vexes y todo está bien, igual le cambiaron bujias e hicieron todo lo que mencionaste y de momento se apaga pero despues de usarla un rato, el motorcito amarillo vuelve a prenderse.
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
Hola Kaly, púes ya tiene un día que desconecte la batería (la deje como 5 horas desconectada) y no se ha vuelto a prender, pero ya me había pasado antes, que se apagaba por uno o dos días y se volvía a prender, así que estoy en tiempo de prueba. Cualquier cosa aviso, si resulta debemos darle las gracias a LexUAG. Suerte
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
Saludos, desgraciadamente ayer se volvió a prender el "motorcito" y ya no se ha apagado. Creo que no funcionó desconectar la batería. Si saben de alguna otra cosa por favor informenlo.
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
Es importante que en el escaneo no te de codigos llevalo a que lo scaneen un autozone y diles que te den los codigos y los mandas
Mi correo es
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
Gracias Rodrigo, lo llevo a autozone y pregunto sobre los códigos. Saludos
hace 2 años
Mejor solución  (según Patricia, el autor del problema) 
 Ford Ecosport  2005 · 4 puertas zetec 1.6 xls · 101800 kms
Hola amigos, espero que me ayuden, ya que hace un mes me compre este vehículo ecosport xls 1.6 usado del año 2005 con mas de 101.000 km.. . El problema consiste que en el momento de exigir el motor de 2000 a 3000 rpm cuesta a que agarre velocidad sobretodo en segunda marcha hacia adelante... en carretera pasa lo mismo ,cuando me he enfrentado en subidas simples a 100 km/h pierde mucha potencia y con el acelerador a fondo, espero que me ayuden ya que por el momento estoy un poco decepcionado por la compra y espero que exista alguna solución... SALUDOS
hace 2 años
y otra persona con el mismo problema
Respuestas de la comunidad
Tenia el mismo problema y lo solucione cambiándole el ruleman de empuje (es hidráulico). Cambialo antes de que rompas el disco y la placa
hace 2 años
Mejor solución  (según Wersick, el autor del problema) 
Hola amigo, te comento una falla que tubo la mia que es una tdi 1.4 diesel, (te puede ser uti)l; le paso lo mismo, perdia fuerza, y resulto ser el sensor MAF que esta antes del turbo, es el que le da la señal de paso de aire al motor, la pieza no se repara, tenes que reemplazarla.
hace 2 años
Fernando (PAI)Hola amigo, aun tienen la Ecosport 1.4? la mia esta desforzado, no se si es el turbo o que? no desarrolla los cambios no tienen potencia esta lenta, soy de Honduras
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
AndresHola Fernando vos leistes los comentarios que yo hice con ese problema decime si todas las probalidades que yo dije estan probadas si no los leistes vere de pasartelas otra vez por lo menos lo que yo tuve de esperiencia en que no tenia fuerza fijate un saludo cualquier cosa hablame no tengo problemas en lo que te pueda servir a tus ordenes
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
Fernando (PAI)Andrés teagradezco tu respuesta, solo ví tu respuesta de cambiar el disco de clutch , hace varias semanas repare los sincronizadores de la caja , pienso y creo que exista esa posibilidad de que sea el disco de clutch, pero un mecánico dice que cree que sea el turbo, mañana limpiarse el sensor MAF, y cambiaré el filtro de Aire. Que me recomiendas?
50497017809 este es mi Whatsapp , te agradecería si me escribes, disculpa la imprudencia ,
Saludos, Bendiciones.
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
pegezetaHola fernando!!, el problema lo resolvi reemplazando el sensor MAF, no lo limpies, solo sacalo y pone uno nuevo, los filamentos interiores se desgastan por erocion del aire con micro-particulas, despues de cambiarlo mi ecosport acelero a 140 km como nueva!!, saludos y que tengas buena suerte, la verdad que es un muy lindo vehiculo, ideal para viajar tranquilo.
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
AndresQuedate tranquilo que esta todo bien de todas maneras esto uno lo va haciendo de onda y preguntame las veces que quieras en lo que te pueda ayudar te lo mando ,en lo que respeta al auto teneme al tanto como va y si lo solucionas porque a mi tambien me interesa, en vacio acelerandolo es decir parado el auto tampoco tiene fuerzas como para levantar 4000 vueltas , porque si en vacio no tiene fuerzas el embrague no tiene nada contestame eso un saludo Andres de barracas
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
pegezetaHola fernando!!, el problema lo resolvi reemplazando el sensor MAF, no lo limpies, solo sacalo y pone uno nuevo, los filamentos interiores se desgastan por erocion del aire con micro-particulas, despues de cambiarlo mi ecosport acelero a 140 km como nueva!!, saludos y que tengas buena suerte
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
AndresHola soy Andres de barracas el sensor MAF cual es el que esta en el volante tambien llamado sensor de giro contestamelo por favor gracias amigo--
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
pegezetaHola andres, no, el sensor MAF esta a la entrada del Turbo, es el que da señal al turbo para que genere mas o menos energia, parece una pulsera de tobillo tipo arresto domiciliario!! jaja!
(googlea una imagen de "sensor Maf ecosport")
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
Fernando (PAI)Pegezeta Paul, te agradezco por tu ayuda , ya resolví el problema , estaba sucio el sensor MAF lo limpie con Alcohol y la grasa o sucio como. Lodillo. Lo desprendible con Agua Caliente cuidadosamente claro, saludos.
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
AndresGracias muchacho buena explicación y me alegro que hayan resuelto el tema un saludo y otra vez gracias ------Andres de barracas
hace 3 meses
Mejor solución  (según Wersick, el autor del problema) 
Mejor solución  (según Wersick, el autor del problema) 
Hola ya se resolvió tu problema?? Yo ando igual
hace 2 años
Mejor solución  (según Wersick, el autor del problema) 
Lamentablemente aun no he encontrado la solución del problema... llegué a la conclusión de que el motor está desgastado, una lastima...
hace 2 años
Mejor solución  (según Wersick, el autor del problema) 
Hola soy Andres de barracas en esa falla habria que determinar primero si cuando vos vas con el acelerador a fon y no hay fuerza notas que la camioneta va acelerada es decir el motor va a unas 2500 o 3000 revoluciones y no tiene fuerza en este caso en particular me toco a mi y era que patinaba el embrague se le hizo el embrague y solucione el problema , en cambio si las vueltas del motor no suben estas con otra falla que puede ser de insuficiencia de bomba de combustible o mismo un tema electrico----
hace 3 meses
jonnyHola tengo compre una ecosport hace unos dias mod 2004 1.6 naftera con gnc. Siempre tuve auto y acostumbre hacer los cambios alas 2mil vueltas o solo un poquito mas. Y noto que en la eco tengo que hacerlo a las 2500 o 3mil vueltas. Mucho mas en gnc. Es normal en este vehículo? Con gnc se achancha mucho? Tanto que cuesta mucho subir una subida con gnc?
hace 2 meses
Mejor solución  (según Wersick, el autor del problema) 
pegezetaHola Jonny!, tene en cuenta que el GNC se usa mas que nada para ahorro de combustible, en algunos motores es recomendable cuando acostumbras a hacer viajes en los cuales el motor va a una velocidad continua, con poca aceleraciones y frenadas, y si tu auto en tercera llega a 80Km y estas entre las 3000 rpm, ponete contento porque es una buena respuesta del motor pequeño que tira una carroceria que es mas pesada que el auto original para el que fue diceñado
hace 2 meses
Mejor solución  (según Wersick, el autor del problema) 
Mejor solución  (según Wersick, el autor del problema) 
Buenos dias...sabes mi eco. No tiene fuerza de salida con el gnc...muchos menos con el aire prendio...el equipo de gnc. Tiene un año y poda la garantia me la pase llevandola a regular pero igual...le cambie 3 veces en el año bujias y cables y nada
hace 2 meses
AndresHola mira primero habria que ver si la eco en vacio se le llama en vacio cuando esta detenida y uno la acelera y levanta muchas vueltas eso vamos a determinar si la falla es del motor que no tiene fuerza o el embrague que patina , yo por lo menos tuve la esperienza esa de que no tiraba cada vez menos y no podia salir de un estacionamiento con subida y era el embrague que patinaba tendrias que hacer esa prueba y contame Andres de barracas---
hace 2 meses
Mejor solución  (según Wersick, el autor del problema) 
KARINAHola me fije ,y parada acelerando sube a 4.000 vueltas y mas acelerando a fondo
hace 2 meses
Mejor solución  (según Wersick, el autor del problema) 
KARINAMuchas gracias. El problema fue solucionado...tenia la manguera de entrada del gas apretada...gracias
hace 2 meses
Mejor solución  (según Wersick, el autor del problema) 
Mejor solución  (según Wersick, el autor del problema) 

 Ford Ecosport  2007 · 84500 kms
No ha manifestado ninguna falla que haya podido detectar aun.
Yamina SosaVenezuela
hace 8 meses
y otras 7 personas con el mismo problema
Respuestas de la comunidad
A mi me ocurre lo mismo la luz testigo del motor se enciende dura así uno o dos días, y después se apaga, sin presentar ninguna falla. A veces creo que es la calidad del combustible. De alguna manera esto ocurre cuando se tiene menos de un cuarto de tanque. Recién cambie batería porque saco la mano la que tenia, lo raro es que el testigo de batería nunca reporto falla voy a mirar si eso soluciono lo otro, si en quince días no enciende esa luz de falla te cuento. Por ahora estamos en tarea de investigar de que se trata.
hace 8 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Se me olvido comentarte la mia es una Ecosport 2011
hace 8 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Hola Eugenio, gracias por tu comentario, revise un poco y solo observé que los bordes de la batería estaban sulfatados, los limpié y supongo que al desconectar los bornes se reseteó la computadora y la luz no volvió a aparecer. La mia es una Eco Sport 2.007 Automática. Saludos.
hace 8 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Hola Yamina no me volvió a encender la luz de motor de manera que si esta relacionado con la batería veo que a ti también se te soluciono por la misma causa, los bornes sulfatados hacen que el voltaje baje por mal contacto en mi caso tenia una celda dañada la batería menos mal no me varé porque mi caja también es automática. De todas maneras cargo el cable para emergencias, (te lo recomiendo uno nunca sabe) siento una gran felicidad porque compartimos y solucionamos el problema.
hace 8 meses
Mejor solución  (según Yamina Sosa, el autor del problema) 
Hola tengo una eco 2013, y he sufrido las grandes fallas de la marca, el sensor de oxigeno, no sirve, el catalizador no dura nada, para los combustibles actuales, lo que la hace mas lenta, y si lo cambias tiene que ser todo el caño, porque viene ermético, o sea no se puede cambiar solo el catalizador, las chapas de las puertas se rompen como juguetes, tales asi que el ensamblador de Brasil a mandado a cambiar todas las chapas por chapas iguales, por lo que el problema seguira, el compartimiento del techo le suena todo, los guarda barros traseros de tela, al mojarse con la lluvia se bajan por el peso, y chocan contra la llanta desgastandolo, las juntas de goma de las puertas todas se han partido, y salido por pedasos, no son resistentes, la lona interior del capo ni hablar es un desastre, la verdad pienso que Ford esta perdiendo credibilidad con este modelo, o aposto mal por este ensamblador en Brasil.
hace un mes
CarlosHa se me olvidaba lo mas importante, que la luz en forma de motor, es por el catalizador defectuoso o sucio, por eso el vehiculo sigue funcionando normal, pero mas lento
hace un mes
Mejor solución  (según Yamina Sosa, el autor del problema) 
EugenioHable con un técnico de La Ford en mi ciudad y me dice que esa luz puede encender por cualquier mal funcionamiento te comento que me repitio la encendida de la luz pero esta vez se debía al filtro de la gasolina que no lo había cambiado y estaba bastante sucio
Cambie el filtro de la gasolina y me explicaron que por falta de presión que se perdía en el filtro encendía la luz de motor
hace un mes
Mejor solución  (según Yamina Sosa, el autor del problema) 
Mejor solución  (según Yamina Sosa, el autor del problema) 
 Ford Ecosport  2088 · 4 puertas full motor diesel 1.4 · 130000 kms
Estaba todo normal, de pronto no arranco mas, se encienden todas las luces en en tablero, con el candado, que no me deja encenderla, revise las baterías de los controles, las llaves, la bateria esta bien ajuste los bornes y esta todo bien, me podría guiarme para saber que hago, desde ya muchas gracias. El modelo es 2008
hace 2 años
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Disculpa eel modelo es 2008
hace 2 años
orlandoLa camioneta es 2008, le puse corriente directa al arranque y da marcha pero no enciende y por la llave no solamente encienden las luces del tablero. Alguien me puede ayudar
hace 3 meses
Mejor solución  (según Raul, el autor del problema) 
Mejor solución  (según Raul, el autor del problema) 
Hola viejo me pasa lo mismo que a vos... pudiste solucionarlo? saludos
hace 2 años
Mejor solución  (según Raul, el autor del problema) 
Hola me paso lo mismo, el problema es los cables que van al computador estaban rotos
hace 2 años
Mejor solución  (según Raul, el autor del problema) 
Verifica que el fusible de encendido no esté abierto, si no es eso verifica que encienda empujando en 2da. Y si arranca así entonces esta pidiendo cambio de carbones del arrancador que se cambian cada 2M km. suerte.
hace 2 años
victorY si esra abierto walter
hace 3 meses
Mejor solución  (según Raul, el autor del problema) 
Mejor solución  (según Raul, el autor del problema) 
Buenos dias, tengo un problema similar, la camioneta en ocasiones arranca sin problema, pero en ocasiones no, la primera vez que fallo, me dijeron que era el sensor de posición del cigueñal, curiosamente solo lo limpiaron y arranco, pero despues hizo lo mismo, como la bateria estaba ya muy usada, no le podia dar mucha marcha por que se descargaba, un mecanico la llevo jalando a su taller y cuando llegue ya estaba arrancada, me dijo que por la bateria no llegaba buena corriente y por lo tanto no arrancaba, la tercera vez que acudi con un mecanico, no estaba fallando y la lleve para que la revisaran, me dijo que la bobina no estaba enviando la corriente suficiente y se la cambio, pero hoy por la mañana de nuevo no arranco, sali caminando al trabajo, pero mas tarde mi esposa le dio marcha y arranco sin problema
Ya no se que mas hacer, por favor alguien puede apoyarme?
hace 2 meses
OmarHola a mi me pasa algo similar en diesel, y me dijeron que es el sensor de temperatura de combustible, que cuando está fria arranca pero en motor caliente ni por casualidad
hace 16 días
Mejor solución  (según Raul, el autor del problema) 
Mejor solución  (según Raul, el autor del problema) 
Ando con la ecosport la paro y hace un ruido pub pub pub como si viniera del caño de escape halguien podra desirme que es
hace 2 meses
Mejor solución  (según Raul, el autor del problema) 
 Ford Ecosport  2004 · full, motor 1.6 · 100000 kms
En frio arranca sin problemas,luego de andar un rato al pararla no arranca mas,la dejo unos quince minutos y arranca,tiene todo nuevo: bobina,burro ,bateria,etc.. .
hace un año
y otras 5 personas con el mismo problema
Respuestas de la comunidad
Hola soy marcelo a mi me pasa lo mismo, quisiera seber si alguien puede Ayudar. Gracias
hace un año
Mejor solución  (según berto, el autor del problema) 
A mi también me sucede lo mismo ojala y alguien pueda ayudar
hace un año
Mejor solución  (según berto, el autor del problema) 
Hola, Primero que nada, le conectaste un escáner?, como para arrimar alguna solucion.
hace un año
Mejor solución  (según berto, el autor del problema) 
Buenas me salia el sensor de árbol de levas se lo reemplaze ayer y no me quería arrancar después arrancó di una vueltas y la apague y arrancó de nuevo pero tengo que seguir probando
hace un año
Mejor solución  (según berto, el autor del problema) 
Si,dos veces,no sale absolutamente nada. He probado de todo y el problema subsiste. Le puse el arbol de levas nuevo.
hace un año
Mejor solución  (según berto, el autor del problema) 
A mi en el escanee me aprecia sensor de árbol de lleva se lo cambie y al parecer solucione
hace un año
Mejor solución  (según berto, el autor del problema) 
Hoy lo probé mejor recorrí 300 kilómetros la apague y si prendió creo que solucione
hace un año
Mejor solución  (según berto, el autor del problema) 
Hola. Me alegro <kelvis, que lo solucionaste. Ahora Berto, deja de cambiar cosas por cambiar. Que cuando tengas que comprar el repuesto correcto, no vas a tener guita... Asumo que tu eco, es naftera, asi que, probale la presion de bomba. Tiene que andar por los 3 Bar. Avisame...
hace un año
Mejor solución  (según berto, el autor del problema) 
Ahora Berto, deja de cambiar cosas por cambiar. Que cuando tengas que comprar el repuesto correcto, no vas a tener guita... Asumo que tu eco, es naftera, asi que, probale la presion de bomba. Tiene que andar por los 3 Bar. Avisame...
hace un año
Mejor solución  (según berto, el autor del problema) 
Ok,gracias, te aviso,voy a probar probando presion a la bomba
hace un año
Mejor solución  (según berto, el autor del problema) 
Ok, dale que lo vamos a solucionar...
hace un año
Mejor solución  (según berto, el autor del problema) 
Hola amigos soy de santa fe argentina y el problema que tiene su ecosport de no arrancar en caliente es que la computadora de la camioneta tiene una protección por elevada temperatura eso sucede cuando pasa dos o tres grados del limite interno yo para solucionar el problema sin tener que cambiar la computadora le hice una conexión directa con una llave al electro ventilador y mientras cargo combustible dejo el electro en marcha cuando bajo dos grados arranca sin problemas
hace un año
Mejor solución  (según berto, el autor del problema) 
Ok,juan,gracias por el dato,voy a probar tu consejo y te aviso,abrazo
hace un año
Mejor solución  (según berto, el autor del problema) 
Hola a todos tengo la nueva eco mod 2013 a gnc. Paro en caliente y no arranca mas debo empujar o dejarla enfriar una hora. Que hago? Ya compre bobina nueva aun no la puse. Sera la solucion?
hace un año
Mejor solución  (según berto, el autor del problema) 
Hola a mi me pasa lo mismo, tira el mismo error del sensor de árbol de levas, ya le cambie ese y el del cigüeñal y nada sigue igual lo hace cada tanto, ya revise bomba y esta bien, cambie bujías, limpie cuerpo mariposa y cambie filtros y nada... si alguien lo soluciono me pasa info GRACIAS!!!!!
hace un año
Mejor solución  (según berto, el autor del problema) 
A mi me pasaba lo mismo pero desmonte el arranque yo mismo y le hice mantenimiento en la parte donde van los carbones y se le quitó tiene tiempo que no la empujó
hace un año
Mejor solución  (según berto, el autor del problema) 
Pero el arranque gira no es el problema, acá es como si por un momento la computadora no manda la orden de chispa!!!!
hace un año
Mejor solución  (según berto, el autor del problema) 
Alguno pudo resolver?
hace 4 meses
Mejor solución  (según berto, el autor del problema) 
Me dijeron que es el sensor de temperatura de combustible, que cambiando eso ya esta. Vi que el mecanico le echa w40 cuando no arranca, pero no vi donde, al menos para salir del paso, apenas tenga mayores datos les aviso
hace 16 días
OmarAclaro por las dudas, esta es Diesel
hace 16 días
Mejor solución  (según berto, el autor del problema) 
Mejor solución  (según berto, el autor del problema) 
 Ford Ecosport  2013 · Titanium 1.6 · 6500 kms
Hola, de un dia para otro al encender la Eco, me da el error de "motor averiado, llevar a service urgente", no se que le pasa, andaba de lo mas bien, nunca tuvo ninguna falla, tiene recien 6500 KM, poco uso.
Luis SArgentina
hace 3 años
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Fui al service y me cambiaron la bateria, y problema solucionado.
hace 3 años
Mejor solución  (según Luis S, el autor del problema) 
Hola luis mira tenemos una escort SE de golpe nos salto una falla igua "motor averiado " pero no sabemos que es. En el service te dijeron que es la bateria ? mi cel 2214119424
hace 3 años
Mejor solución  (según Luis S, el autor del problema) 
Hola Luis S también me paso lo mismo de repente se prendió la luz check engine lo lleve al concesionario y según dijeron actualizaron la computadora que controla inyección por ahora esa parte anda bien. Ahora estoy luchando con otro problema de abs la mía tiene 11000 km.
hace 2 años
Mejor solución  (según Luis S, el autor del problema) 
Ma paso lomismo, me aparecio motor averiado y lo lleve, me dicen que es la mariposa o algo asi de lo que se llamaba antes el carburador
hace 7 meses
Mejor solución  (según Luis S, el autor del problema) 
Las veces que la encendia tiraba un error distinto, airbags desactivados, abs desactivado etc, era la bateria, la cambiaron y solucionado. Ya no la tengo mas, me compre un focus titanium
hace 7 meses
Mejor solución  (según Luis S, el autor del problema) 

 Ford Ecosport  2013 · limited · 30000 kms
Ya probe todos los rele y fusibles ,medi la bateria y estaba bien ,probe la otra llave y nada no arranca,le doy arranque y me prende todo el tablero de luces ,pero de arrancar ni enterado esta , alguno tiene idea que hacer o que puede tener
hace un año
Respuestas de la comunidad
Si es automatica , muevele la palanca en todas las posiciones ,se debe de haber pegado el quick dow (interruptor de seguridad ) para que no de arranque estando en una velocidad. Lo pones en n y debe de arrancar.
hace un año
Mejor solución  (según fabian, el autor del problema) 
No es caja automatica ,tiene caja convencional ,hoy probe conectarle otra bateria con cables por las dudas si tuviera un vaso cortado ,yyyyyyyyyyyy nada ,no arranca
hace un año
Mejor solución  (según fabian, el autor del problema) 
Si es estandar revisa el interruptor de encendido que esta en el pedal del clutch , es el que hace contacto para el arranque. De preferencia, no hagas el arranque auxiliar con cables , se puede quemar la computadora por un falseo. Es mejor conectarle otra bateria, ya varias personas han reportado ese problema.
hace un año
Mejor solución  (según fabian, el autor del problema) 
Dinde esra el pedal del clutch
hace un año
Mejor solución  (según fabian, el autor del problema) 
Mirá a mi me paso algo muy parecido. La bateía entro en corto. Como el auto esta en garantía me la cambiaron sin ningún costo
hace un año
Mejor solución  (según fabian, el autor del problema) 
Hola soy Andres de barracas fijate o hacela mirar y que te cambien el sensor o captor de giro que esta ubicado enel volante del motor pero se puede cambiar -----
hace 3 meses
fabianYo ya lo solucione ,me dijeron en la agencia que habia que cambiar unos sensores ,precisamente 3 , 18 000 $ era el costo ,fui de un amigo ,cambiamos la bateria y se soluciono todo anda excelente ahora ,yo creia que no era la bateria porque andaban todas las luces y todo el tablero tambien asi que era mas facil de lo que creia y mas barato , lo que iso fue conectar los cables de la bateria de la camioneta con otra bateria ,la saco y conecto otra bateria nueva sin sacar los cables para que no se descodifique nada
hace 3 meses
Mejor solución  (según fabian, el autor del problema) 
AndresGracias Favian por habermelo comentado queda en el libro de fallas un abrazo Andres
hace 3 meses
Mejor solución  (según fabian, el autor del problema) 
Mejor solución  (según fabian, el autor del problema) 
 Ford Ecosport  2015 · SE 1.6 Nafta · 47000 kms
Gracias por la aceptación. Vivo en zona limítrofe y en Argentina uso en los servicios Elaion sintético cada 15000 km como aconseja el manual de mantenimiento. Averigüé en Uruguay y en los servicios (son agentes oficiales Ford) usan Texaco semi sintético cada 10000 km.
¿eso me podría acarrear algún inconveniente a futuro? gracias.
hace 8 meses
Respuestas de la comunidad
Los mejores aceites atomotrices son sinteticos. Mientras sea una marca certificada por la marca automotriz no hay problema mas que realizar los cambios , mas frecuentemente. El aceite mineral se cambia cada 5,000 KM. el semi-sintetico cada 10,000 KM. y el sintetico cada 15,000 KM.
hace 8 meses
Mejor solución  (según Tony, el autor del problema) 
Gracias Ricardo. Muy clara tu respuesta.
hace 8 meses
Mejor solución  (según Tony, el autor del problema) 
 Ford Ecosport  2013 · ford ecosport · 20000 kms
De repente se enciende abs averiado , luego se bajan la luces, y todo, y no parte mas, le paso cte. Y vuelve a encender, q pasa ??' o que problema puede tener, sera la bateria mala
hace 3 años
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Me acaba de pasar los mismo, luego arranco y llegue a destino hice 200 nkm. No superaba los 100 km por hs. Al llegar apague el motor le di arranque y funcionaba normalmente que pudo haber fallado ?
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Hoy me iva de vacaciones, y me paso lo mismo, lo apague y no encendio mas quedo muerto nada de nada. La misma leyenda ABS averiado
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Bueno al parecer los defectos electricos que acusan todos son similares el problema esta uando la detienen y se enciende nuevamente. Pero hay algo para tener en cuenta se puede detener en uso por carretera lo que es una trajedia ya que se detiene todo y queda sin control. Esto hace que sea peligroso de accidentarse. Luego de denerse no hay sistema electrico que funcione todo queda anulado, se aplica energia con otra bateria y arranca y se normalisa de a poco , es todo un tema tenganlo en cuenta si encuentran la solucion les informo. Sds.
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Parece ser un problema recurrente. Tengo una Ecosport KD SE 1.6 N 2013 y ya me desactivo sucesivamente los sistemas 2 veces en funcionamiento con el mismo mensaje de averia. Le cambié la bateria en enero de 2015 luego de la primera vez y ahora en mayo me volvio a hacer lo mismo. La lleve a revisión a Russoniello la tuvieron 3 días y me dijeron que estaba todo OK. Al día siguiente al encenderla "Averia motor" servicio inmediato. Ya escribi a FORD y ahora nuevamente en revisión... Encima me desactivó el vehículo 2 veces en avenidas transitadas. Es criminal lo de FORD
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Hola les comento que el problema es de cableado y se tienen que cambiar varios cables que se sulfatan al recalentarse esto es por mal calculo en el pasaje de la carga lo que hace al problema lo solucionan con el cambio y ademas la bateria ya que se pone dura y no recibe carga y tienen que cambiar. A partir de los cambios se normalizara todo. Esto lo hacen en el concesionario.
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Hola Ecosport ! Es la primera vez que alguien indica el motivo de la falla. Tiene idea si las agencias de Ford lo saben ? Yo tengo el auto en revisión por segunda vez en una semana y no tienen idea remota de que ocurre. Toda información adicional le agradeceria.
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Si en primer lugar busque la informacion y luego pedi turno de en la concesionaria explicando el problema al jefe de servicio , quien dijo que es una falla casi comun y que se repara ria en garantia. Y asi fue sin costo alguno y en buen funcionamiento hasta hoy. Espero les sea bueno el informe. Slds.
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Muchas gracias Ecosport! En que concesionaria pudo realizar la reparación en forma exitosa ? Me seria de gran utilidad para terminar con estos problemas.
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Sauma , San isidro. Slds
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Muchas gracias Ecosport por su información!
hace 2 años
Mejor solución  (según caco, el autor del problema) 
El problema se encontraba en un cable del mazo de cables que están debajo del torpedo. Tuvieron que desarmar todo hasta dar con el fallo. Al aprisionar de fábrica a éstos, la misma maquina cuasi seccionó a uno de ellos con las fallas de abs averiado etc. que realiza la computadora como autoprotección. No eran los cables a maza recurrentes al chasis que se rompen ni la bateria. Espero que les sirva a los usuarios de Ecosport.
hace 2 años
Mejor solución  (según caco, el autor del problema) 
Me volvio a pasar volvia de vacacionesse encendio luz abs y al frenar por un camion se apago todo, no la quiero mas la vendo me desepciono.
hace 2 años
Mejor solución  (según caco, el autor del problema) 
 Ford Ecosport  2014 · Titanium  · 12500 kms
Al encenderlo aveces cuesta luego de varios intentos se logra. Al encenderlo dice falla de motor y se desactiva el control de estabilizador y freno de pendiente... esto sucedió una vez y luego se arreglo sólo, duro como tres días bien y ahora volvió y suena la alarma cada vez que lo enciendo acusando falla no se que hacer ayuda por favor si alguien le ocurrió lo mismo para ver que puedo hacer ya no tengo garantía así que estoy tratando de hacer un arreglo
hace un año
y otras 8 personas con el mismo problema
Respuestas de la comunidad
Cuando se vaya a llenar el tanque de gas ,agregale antes,un limpiador de inyectores de buena calidad va a limpiar todo el sistema de inyeccion : filtro. Bomba,regulador de presion de combustible,inyectores,cuerpo de aceleracion ,valvulas, sensor de oxigeno ETC. si lo haces cada 6 meses o una ves al año. No tendras fallas en el sistema combustion.
hace un año
Mejor solución  (según Dany, el autor del problema) 
Gracias lo haré me tiene super estresada el tema del jeep
hace un año
Mejor solución  (según Dany, el autor del problema) 
Estoy de acuerdo compañeros
hace un año
Mejor solución  (según Dany, el autor del problema) 
Mi ecosport presenta kla misma falla y la lleve a la agencia y me comentan que es el cuerpo de aceleracion elque falla y manda errores. Sera cierto?
hace un año
Mejor solución  (según Dany, el autor del problema) 
Tocayo. - el cuerpo de aceleracion es normal que se ensucie con el uso, por la gasolina que forma gomas en su interior. Aplica el 1er. Comentario , debe mejorar
hace un año
Mejor solución  (según Dany, el autor del problema) 
Hola dany. A mi me tira el mismo error cada vez q enciendo la eco... sistema de freno averiado. Frenopendiente y control de traccion queda encendido... Vos pudiste solucionarlo... te resulto lo del liquido para limpieza de inyectores?... saludos...Laura
hace 3 meses
DanyHola Laura sabes lo lleve al concesionario y era sólo una falla de los sensores que están debajo del volante, estaban sueltos y desde eso no he tenido más problemas
hace 3 meses
Mejor solución  (según Dany, el autor del problema) 
Mejor solución  (según Dany, el autor del problema) 
De golpe se me prendieron las luces de control de traccion, control de estabilizacion y freno de pendiente desactimado todo en casi el mismo momento, no se que puede ser a alguien le paso.
hace 3 meses
DanyA mi pero sólo fueron unos sensores o que estaban sueltos estos están debajo del volante en una cajita
hace 3 meses
Mejor solución  (según Dany, el autor del problema) 
norbertoGracias por la respuesta, les cuento que al otro dia, cuando puse en marcha el auto, estaba todo normal, y al dia de hoy sigue normal sin encender las luces y todo funcionando con normalidad.
hace 2 meses
Mejor solución  (según Dany, el autor del problema) 
Mejor solución  (según Dany, el autor del problema) 
Puede ser que la bateria ya no retiene la carga suficiente, si ya tiene mas de año y medio de uso es posible que sea la causa ,le a pasado a otros.
hace 3 meses
DanyLa batería me duró como dos años la cambié recién el mes pasado en diciembre antes era por unos sensores desconectados que el computador se volvió loco
hace 3 meses
Mejor solución  (según Dany, el autor del problema) 
alexDany. Y que combustible le pones. A mi me pasa lo mismo despues de la mantencion
hace 2 meses
Mejor solución  (según Dany, el autor del problema) 
DanyUso 93 siempre nunca le he echado de otra
hace 2 meses
Mejor solución  (según Dany, el autor del problema) 
alexGracias yo igual el mismo octanaje. Hoy en la mañana se borro el mensaje de estabilidad pero continua el del check y de averia motor. Pero pude andar un poco normal porque sigue trabajandomal el motor. Como en tres cilindros.
hace 2 meses
Mejor solución  (según Dany, el autor del problema) 
alexLes cuento amigos. Tenia problemas con el check que se prendia. Al pasar unos dias se prendio la luz de estabilidad y frenos y un simbolo de exclamacion y perdia fuerza el motor. Lo lleve al mecanico y le hizo escaner y me dijo que cambiara bujias y bobina lo cual le dije que estaban buenas y lo hizo igual en todo me salio 120 mil pesos. Y el problema continuo. Gracias a algunos tips que saque del foro yo mismo saque la mariposa del sistema de aceleracion ,lavlimpie y solucionado el problema. Tambien aprobeche de revisar el sensor de gases y estaba limpio. Ojala le sirva alguien mi maquina es una eco sport titanium 2013
hace un mes
Mejor solución  (según Dany, el autor del problema) 
Mejor solución  (según Dany, el autor del problema) 
Gracias por tu respuesta...en la semana lo veo... espero q se solucione...igual me olvide de aclarar q no solo se enciende la falla del freno de pendiente sino q ademas efectivamente... no me frena en pendiente... vere con los sensores q decis... sino... a una agencia ford... $$$ 😕
hace 2 meses
Mejor solución  (según Dany, el autor del problema) 
 Ford Ecosport  2016 · Titanium  · 550 kms
Me subí y está en parking, apretó freno para darle Staricco y no prende
hace 7 meses
y otras 6 personas con el mismo problema
Respuestas de la comunidad
Son defectos de calidad de fabrica ford. Sobre todo las titanium. Tiene garantia ,avisa que te la vayan a revisar al distribuidor. Revisa si el tapete no esta interfiriendo con el pedal de freno para conectar el interruptor de encendido.
hace 7 meses
Mejor solución  (según Emiro, el autor del problema) 
Solucione tema, les comento que estaba el borne positivo (batería) "prendido en un hilo" y no le daba para circular la corriente. La verdad que una falta de todo un poco al pasar esto en un vehiculo 0 km.
Lo las triste aun el representante de Ford en Uruguay (Multimotors) me dejo dos días tirado sin solucionarme el tema y ni fueron capaces de al menos hacer una llamada. Como cliente de Ford expreso mi descontento con toda la atención.
hace 7 meses
Mejor solución  (según Emiro, el autor del problema) 
Buenas tardes el carro no enciende ya probamos con el tapete y también con la batería. Apenas tiene 10 meses
hace 7 meses
Mejor solución  (según Emiro, el autor del problema) 
Es muy lamentable que los ford desde nuevos esten presentando tantos defectos, reportalo al distribuidor para que lo vayan a revisar en donde quedo. Tiene garantia
hace 7 meses
Mejor solución  (según Emiro, el autor del problema) 
Sigo con los problemas en mi titanium con casi 1000 kmts, en la región que vivo llueve desde hace una semana y me he dado cuenta que tengo una "piscina" en la camioneta. En los pies del asiento de atrás lado derecho esta toda la moquete mojada. Lo seque pero se sigue mojando y ahora junto mucha agua. La verdad un desastre FORD con estos detalles
hace 7 meses
Mejor solución  (según Emiro, el autor del problema) 
 Ford Ecosport  2006 · 4 puertas 1.7 motor · 93000 kms
Buenas noches espero puedan ayudarme el momento de ir de subida y meter los cambios lo que es primera y segunda empieza a vibrar demasiado la parte del motor y pierde un poco de potencia y sé siente un poco mas cuando llevo el clima encendido, pedí un escaneo y apareció Cómo falla el catalizador no se si vaya por ahi espero puedan ayudarme
hace 2 años
y otra persona con el mismo problema
Respuestas de la comunidad
Si ami me esta pasando lo mismo y anda como en tres cilindros vino mi viejo y me dijo que era el catalizador por que a mi viejo le paso lo mismo con el vehículo que el tiene se canso de gastar plata y al cuete le cambio el catalizador y santo remedio
hace 2 años
Mejor solución  (según emmanuel, el autor del problema) 
Muchas gracias por tu comentario en verdad pues entonces le empesare a checar por ahí gracias nuevamente
hace 2 años
Mejor solución  (según emmanuel, el autor del problema) 
A mÍ me pasó algo parecido con mi ecosport 2014, cuando solo tenía 2500 km. En 4ta y 5ta no tenía fuerza y el motor vibraba mucho. Un mecánico lo escaneo y me dijo que se había apagado un cilindro. Reseteó el computador y listo, nunca más ha fallado. Luego me explicó que probablemente le entró alguna basurita, ya que los sensores son muy sensibles y detectan cualquier anomalía y que a manera de prevención, automáticamente se apaga un cilindro.
hace 2 años
Mejor solución  (según emmanuel, el autor del problema) 
Amigo tenía la misma falla realice cambio de bobina y listo
hace 2 años
Mejor solución  (según emmanuel, el autor del problema) 
 Ford Ecosport  2007 · 171000 kms
Que aceite de motor me recomiendan para mi camioneta Ford Eco Sport 2007 mi pregunta en especial tiene que ser sintetico ya pasaron diez años un aceite en especial me recomiendan un valvoline pero me dicen que no sea sintetico espero una respuesta.
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Ese motor lleva aceite sintético 5w30 toda la vida útil del motor sin importar el kilometraje o años de uso. El aceite Castrol es de los mejores
hace un mes
JerryGracias x tu comentario amigo y gracias
hace un mes
Mejor solución  (según Jerry, el autor del problema) 
Mejor solución  (según Jerry, el autor del problema) 
 Ford Ecosport  2014 · Titanium 1.6 · 5000 kms
Me fui a la playa sin ningun problema, al segundo dia la saco para ir a comprar y cuando llego al local la estaciono y me dale el mensaje en la pantalla, "baja presion de aceite en el motor, psre con cuidado". No arrancó mas.
hace 3 años
Respuestas de la comunidad
Hola me pasa lo mismo, como lo solucionaste? muchas gracias
hace 2 años
Mejor solución  (según Pris, el autor del problema) 
La deje ahi, la fui a buscar a las 2 horas a ver si partía y partió. Volviendo de la playa la lleve al servicio tecnico. Me dijeron que en la memoria quedo registrado el problema pero no sabian el motivo, me cargaron el programa de nuevo como precaucion y un sensor que existe lo limpiaron. No me ha vuelto a pasar ya mas de un año de eso.
hace 2 años
Mejor solución  (según Pris, el autor del problema) 
 Ford Ecosport  2003 · 180649 kms
Hola buenas noches,el problema es que el vehiculo arranca bien y regula,pero cuando trancito tironea o se apaga el motor,eso pasa cuando quiero subir la dijeron que puede ser el sensor de eselerador,pero no se donde se encuentra,decearia me den una respuesta a mi problema,desde ya se lo muchas gracias,
hace 8 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Es el sensor tps el que controla electronicamente la aceleracion ,esta en el cuerpo de aceleracion.
hace 8 meses
Mejor solución  (según jorge, el autor del problema) 
Muchas gracias Ricardo. Pero donde se encuentra el cuerpo de aceleración???
hace 8 meses
Mejor solución  (según jorge, el autor del problema) 
El cuerpo de aceleracion es donde termina la manguera del filtro de aire.
hace 8 meses
Mejor solución  (según jorge, el autor del problema) 
Muchas gracias Ricardo!!
hace 8 meses
Mejor solución  (según jorge, el autor del problema) 
 Ford Ecosport  2008 · 1.6 nafta · 118 kms
Estaba andando y se me bloqueo auto...prendio un luz tablero que muestra un candado y un outo llaveado
marcos sArgentina
hace 2 años
Respuestas de la comunidad
Se te inmobilizó el auto, cambiá de llave, supongo que tendrás otra llave.
hace 2 años
Mejor solución  (según marcos s, el autor del problema) 
Me paso lo mismo, cambie la llave por que segun el manual es q no reconoce el codigo de la misma, pero la falla persiste, sigue bloqueada hay otra cosa para revisar?? puede que sea el tambor??
hace 2 años
Mejor solución  (según marcos s, el autor del problema) 
No creo, el inmobilizador se encuentra dentro de la ECU, hay que sacarla y desinmobilizarla.
hace 2 años
Mejor solución  (según marcos s, el autor del problema) 
Amigo mi EcoSport es año 2007 y esta presentando ese bloqueo y queda titilando el candado temgo que esperar mas de media hora que se active para poder prenderla otra vez ya le he llevado a varios Mecanicos escaneo y pare de contar y nada que dan con la falla, me podrias decir donde queda ECU
hace 2 años
Mejor solución  (según marcos s, el autor del problema) 
 Ford Ecosport  2007 · ECOSPORT · 40000 kms
1. Presionar el ajuste del reloj del panel
2. Dejar la llave en posicion de arranque
3. Esperar un par de segundo que saque del panel la alarma parpadeando
4. Dar arranque
5. Siempre parte el auto ( 3 años asi, cero problema )
6. Ok funciona
hace 2 años
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Hola Daniel a mi me pasa que aveces en la mañana al tratar de hacer andar la camioneta hace solo click y quedan tiritando los marcadores de velocidad y revoluciones tambien se resetea la hora y el odometro temporal y queda un sonido como un rele, eso te pasaba y con estos pasos lo solucionaste? en la tarde la trato de hacer andar y parte de una?
hace 2 años
Mejor solución  (según DANIEL HENRIQUEZ, el autor del problema) 
Ok. Eso me pasaba. Y lo soluciono siguiendo los puntos antes indicado. Se me activaba el indicador de la alarma y me bloqueba elmotor de partida.
Ojala te ayude en algo. Daniel
hace 2 años
Mejor solución  (según DANIEL HENRIQUEZ, el autor del problema) 
Hola otra vez Daniel y gracias por tu respuesta de verdad lo que no tengo claro hay que mantener presionado el ajuste del reloj y seguir los otros pasos o solo presionarlo una vez?
Te comento que ya staba sospechando de algun bloqueo porque cuando lo dejo solo con cierre y no con alarma en la noche me partia de una
hace 2 años
Mejor solución  (según DANIEL HENRIQUEZ, el autor del problema) 
 Ford Ecosport  2007 · Motor 1.6 · 175000 kms

Quería ver si me podía ayudar; hace algunos meses mi eco calentó, nunca al punto de cepillarlo, el Mecanico me dijo que no había necesidad, hace unos días empezó a tirar humo blanco y a brincar el carro al punto de que se apaga y le cuesta encender. Ya le cambie el juego de bobinas, pero sigue igual, saben que puede ser?

GeraldCosta Rica
hace un año
y otra persona con el mismo problema
Respuestas de la comunidad
El humo blanco es anticongelante que se esta quemando ,porque se debio haber quemado el empaque de culata por el recalentamiento.
hace un año
Mejor solución  (según Gerald, el autor del problema) 
 Ford Ecosport  2004 · tdci 1.4 · 187000 kms
De llave no arranca y si la empujo arranca pero me deja sin acelerador todos me dicen que tengo que cambiar el motor pero no hace ruidos raro
hace 2 años
Respuestas de la comunidad
Hola loco, comenta mas de tu problrema
hace 2 años
Mejor solución  (según oscar, el autor del problema) 
Hola amigo. Mira la enchufaron en la computadora y le borraron todas las fallas el motor queda caño unos minutos y luego se vuelve a descontrolar si juego con la llave logro que acelere a beses
hace 2 años
Mejor solución  (según oscar, el autor del problema) 
Me pudrió alguien sabe si el motor 1.8 de escor se puede adaptar usando la misma caja y sin sacar el sistema eléctrico sigue funcionando sin sacar la copu
hace 2 años
Mejor solución  (según oscar, el autor del problema) 
Hola oscar, hiciste cambio de motor. ? Si lo hiciste q cuesta un endura 1.8 de escort y como queda. ?
hace 2 años
Mejor solución  (según oscar, el autor del problema) 
No se agan problema que bien lo cambio les cuanto como queda
hace 2 años
Mejor solución  (según oscar, el autor del problema) 
 Ford Ecosport  2009 · full motot 1.6 · 14000 kms
Prende luz de tablero y abeses se apaga y luego buelbe a prender le an puesto la computadora y o borran y los pocos dias prene le puse limpia inllestore y duro 10 dias apagada la tengo a gas funciona ala maravilla solo es e problema me an dicho cualquiera dicen que es la sonda lambda o algosmilar buenos gracias por tener esta pagina que esta muy buena
hace 3 años
Respuestas de la comunidad
FERNANDO, mira yo me compre hace dos semanas una eco 2010 y tambien me aparece un indicador tipo llave de color amarillo en el tablero y segun el manuel dice que es falla del motor, la lleve al tecnico de la agencia y me dicen que es porque le habian pueto nafta super y no de la sin plomo como aconseja el manual, ese dia la escanearon y la luz se fue pero solo pro un dia, todavia sigue prendida pero funciona de diez, a vos todavia te funciona con ese indicador encendido o no?
hace 3 años
Mejor solución  (según fernando, el autor del problema) 
 Ford Ecosport  2005 · XLS 1.6 · 103000 kms
Amigos espero que me ayuden, mi eco en el momento de acelerar le encuentro que esta muy lento y cuesta a que agarre velocidad y en cuestas simples no da mas el motor... ¿que tipos de piezas o partes del motor hay que revisar? espero que me ayuden, saludos...
hace 2 años
Respuestas de la comunidad
Hola mira me paso exastamente lo mismo con mi eco yo le cambie los filtros de aire bencina y limpieza de todos los sensores y conectores y solucionado problema
hace 2 años
Mejor solución  (según Wersick, el autor del problema) 
Puede ser el disco del cloche
hace un año
Mejor solución  (según Wersick, el autor del problema) 
 Ford Ecosport  2015 · ECOSPORT DIESEL · 700 kms
Apenas ruedo con el coche durante 30 min y se enciende el ventilador haciendo un ruido muy muy fuerte
hace un año
Respuestas de la comunidad
Tiene garantia de fabrica , llevalo a la agencia. A revision.
hace un año
Mejor solución  (según MyMl, el autor del problema) 
Llame y me dijeron que era normal que el ventilador se pone en funcionamiento normalmente pero yo creo que de normal no tiene nada. Si esta en garantía. Graciasssss
hace un año
Mejor solución  (según MyMl, el autor del problema) 
Hola proba lavando las paletas del ventilador si queda suciedad ahi pierde equilibrio al girar y zumba como avion
hace un año
Mejor solución  (según MyMl, el autor del problema) 
 Ford Ecosport  2005 · 4 puertas · 120000 kms
Saludos. Prendo el carro y al poco tiempo, el motor acelera y desacelera, no se mantiene la rpm.
hace un año
y otras 3 personas con el mismo problema
Respuestas de la comunidad
La solución a eso es que debe de tener una entrada de aire por o general es una manguera que tiene detrás del radiador la ventilación la corta y por esa manguera es una entrada al vasio si le entra aire el coche empieza a cabecear y se revoluciona
hace un año
Mejor solución  (según Joel, el autor del problema) 
 Ford Ecosport  2007 · 2.0. 4*2 · 134280 kms
Se activa el foco del tablero de temperatura del refrigerante y realmente no se esta calentando el motor dura alrededor de cinco segundos prendido en seguida se prende el foco del sistema de bloqueo y se caen las abujas del velocimetro y revoluciones y se desborran el kilometraje y no se mata el motor pero si la apago ya no vuelve a arrancar tengo que esperar asta que buelva a aparecer el kilometraje y ya arranca alguien puede ayudarme ya cambie el rele de encendido y el rele de activacion del sistema electrico
erik zapataMéxico
hace 2 años
y otras 2 personas con el mismo problema
Respuestas de la comunidad
A mi me sucedio lo mismo, y las fallas son las mismas, después de intentas todo finalmente cambie el cuadro de instrumentos (IC) y el problema se soluciono, esta es mi experiencia, ojala te sirva, solo te aconsejo q si vas a cambiar algo a la adivinanza inicies cambiabdo el cuadro de instrumentos.
hace 2 años
Mejor solución  (según erik zapata, el autor del problema) 
El problema también me paso... puede ser la llave, el cluster o la computadora... chequea la antena y los conectores de la misma... o un cable en corto.
hace 10 meses
Mejor solución  (según erik zapata, el autor del problema) 
Yo tengo el mismo problema y aun no lo soluciono. Desinstalé alarma y cambié termostato, pero sigue igual... ¿A que se refieren con cuadro de instrumentos (IC), es el tablero?

hace 2 meses
Mejor solución  (según erik zapata, el autor del problema) 
 Ford Ecosport  2007 · ej;4 puertas · 162 kms
Ahora no me marca ningún error
hace un año
Respuestas de la comunidad
Cuando prenda el check engine llevalo a un autozone y lo escaneas (es sin costo) haber que codigo de falla registro la computadora.
hace un año
Mejor solución  (según adel, el autor del problema) 
 Ford Ecosport  2013 · trenin · 30000 kms
Sale en el tablero motor averiado y disminuye la velocidad y no entra nada mas que la 1 cambio pero no abanza como que el motor anda pero no abanza
hace un año
y otras 7 personas con el mismo problema
Respuestas de la comunidad
Hola tengo una eco sport 2013 con tan solo 3 años de uso. Y me aparece en el tablero. Una falla. Que dice motor averiado. Necesito repuesta sobre esto en tan poco tiempo
hace 6 meses
DovisonAmi tambien sale la misma falla a que se debe cual es la solucion
hace 2 meses
Mejor solución  (según ramon, el autor del problema) 
Mejor solución  (según ramon, el autor del problema) 
A mi me paso lo mismo y me dijeron q era el cuerpo mariposa xq le saltaba en el scanner. Le puse otro nuevo y sigue pasando lo mismo q puede ser ?
hace 2 meses
DovisonA mi me salio al final que era la batería y el obturador del acelerador se malogro
hace 2 meses
Mejor solución  (según ramon, el autor del problema) 
Mejor solución  (según ramon, el autor del problema) 
Camioneta 2015,falla marca motor averiado,los concesionarios no te dan ni cinco de pelota como se dice en la argentina se nos rien en la cara ,habría que hacerle un jucio por estafa al cliente
hace 2 meses
Mejor solución  (según ramon, el autor del problema) 
 Ford Ecosport  2016 · 4ptas standar · 4480 kms
Al encenderla empieza avibrar leve, andando no vibra ni en carretera, la corrí a 140 km/h y parada también vibra, según la agencia dijo que eran los buzos y 4 veces ingresó a la agencia y no le quitaron la falla, sigue igual ya no pienso llevarla, los demandare en Profeco para que me la cambien o me regresen mi dinero. Alguien tuvo la misma falla? Que fue lo que le arreglaron, gracias.
hace 8 meses
y otras 4 personas con el mismo problema
Respuestas de la comunidad
Aun no me la arreglan sigue igual, la escanearon y no presenta el escáner ninguna falla.
hace 7 meses
Mejor solución  (según Chima, el autor del problema) 
Hola. Tengo el mismo problema, vibra cuando esta parada, ya revisaron las bobinas, bujías, inyectores,cuerpo de aceleración, válvula y manguera pcv y aun persiste. El escaneo no reporta ninguna falla. Necesito ayuda por favor. Gracias
hace 7 meses
Mejor solución  (según Chima, el autor del problema) 
 Ford Ecosport  2004 · 4 puertas full motor 1600 · 69850 kms
La alarma de mi eco dejo de sonar, pero si abre y cierra los seguros de las puertas, pero el detalle esta en que estando el motor encendido, este se apaga cuando se cierran los seguros de las puertas ya sea manualmente o cuando se pone en marcha el vehiculo y supera los 10 km. agradecere cualquier sugerencia.
hace 3 años
y otra persona con el mismo problema
Respuestas de la comunidad
Es el modulo de la alarma cambialo o mandalo a eliminar
hace 3 años
Mejor solución  (según Antonio, el autor del problema) 
 Ford Ecosport  2007 · 5 puertas motor 1.6 · 227580 kms
A la salida sale lento pareciera que no tiene fuerza y despues suelta y queda normal
hace un mes
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Si es de transmisión manual puede ser que requiere cambiar el kit del embrague.
hace un mes
EliasSe le cambio plato de embrague, disco y hasta la bomba, incluyendo la balinera osea se cambio el kid completo y sigue igual
hace un mes
Mejor solución  (según Elias, el autor del problema) 
ricardoSe le puso el kit original ? O generico
hace un mes
Mejor solución  (según Elias, el autor del problema) 
EliasEl kit instalado es original
hace un mes
Mejor solución  (según Elias, el autor del problema) 
ricardoSe purgo bien el sistema ?
hace un mes
Mejor solución  (según Elias, el autor del problema) 
Mejor solución  (según Elias, el autor del problema) 
Me paso algo parecido no tenia fuerza al salir , lo use así unos días hasta que salio un cartel de avería en el motor, lo lleve a la concesionaria y era la llamada mariposa . Con una limpieza se soluciono. Posible falla por suciedad en el combustible.
hace un mes
Mejor solución  (según Elias, el autor del problema) 
Buenos días ahora tengo otro problema y es con el interruptor de encendido del auto cuando retiro la llave y al querer introducir la llave para dar star al auto la llave no entra.
hace 2 días
ricardoEl switch esta defectuoso, llevalo a un cerrajero automotriz
hace 9 horas
Mejor solución  (según Elias, el autor del problema) 
Mejor solución  (según Elias, el autor del problema) 
 Ford Ecosport  2005 · 4 puertas · 132 kms
Saludos, tengo un problema con mi ecosport, cuando esta en minimo se apaga y no enciende la pongo en primera sin el croche metido y le paso la llave el empuje que hace la pongo en neutro y prende enseguida, claro no es todo el tiempo es a veces que lo hace, no se que es pero ya he gastado mucho dinero y sigo con el mismo problema, no sera la bomba de gasolina, !ayudenme por favor no se ya a donde llevarla, gracias
Cira NouelVenezuela
hace 2 años
y otra persona con el mismo problema
Respuestas de la comunidad
Si puede ser la bomba de gasolina la cual debes revisar ya que es un caso muy ocurrente en las ecosport. Pero realmente creo que tu problema es el mínimo, cámbialo por completo ya que no tiene arreglo-
hace 2 años
Mejor solución  (según Cira Nouel, el autor del problema) 
 Ford Ecosport  2004 · 30000 kms
Hola disculpen, mi problema es cuando queda caliente el motor empieza a sacar humo azul y tiene un ruido como a cadenas, hace poco se le cambió los sellos de válvula sin bajar el cabezote. Creen q tenga q bajar el cabezote para q lo rectifique???
hace 7 meses
Respuestas de la comunidad
Hay que cambiar la valvula pcv (valvula de ventilacion del carter) esta en la tapa de punterias conectada a una manguera que va a la admision. Hay que cambiar el tensor de la cadena de distribucion y posiblemente tambien la cadena original.
hace 7 meses
QuiqueRicardo no ubicó esa valvula
hace 7 meses
Mejor solución  (según Quique, el autor del problema) 
Mejor solución  (según Quique, el autor del problema) 
Probablemente ese motor sea 2.0 y no la traiga y venga con valvula egr
hace 7 meses
Mejor solución  (según Quique, el autor del problema) 
Si fue la válvula PCV gracias Ricardo
hace 7 meses
Mejor solución  (según Quique, el autor del problema) 
Hola tuve problemas de calentamiento baje cabezote y rectifique ahora tengo el problema que el mecánico no tiene las medidas de torque alguien me podría ayudar por favor para saber cuáles son las medidas
hace 2 meses
ricardoENTRA a
hace 2 meses
Mejor solución  (según Quique, el autor del problema) 
hace 2 meses
Mejor solución  (según Quique, el autor del problema) 
Mejor solución  (según Quique, el autor del problema) 
 Ford Ecosport  2004 · 95850 kms
Sube la temperatura a mas de la mitad el motoventilador empieza a funcionar después de que la temperatura esta ala mitad ya le cambie el sensor de temperatura
hace 6 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
La ecosport trabaja siempre con la temperatura a la mitad revisa los relays que controlan el electro, estan abajo directamente bajo el electroventilador
hace 6 meses
Mejor solución  (según Gonzalez, el autor del problema) 
Debes verificar que este trabajando la velocidad baja del electro enciende el vehiculo y desconecta el sensor de temperatura y observa que encienda la velocidad baja y luego de 3 segundos encienda la velocidad alta si no esta encendiendo la velocidad baja de tu electro ese es el problema este vehiculo utiliza 2 relay uno para la velocidad baja del electro y otro para la velocidad alta del electro estan ubicados en lado izquierdo del mismo lado que la bateria al lado de la cajera del radiador parte inferior
hace 6 meses
Mejor solución  (según Gonzalez, el autor del problema) 
 Ford Ecosport  2006 · 4 puertas motor 1,6 · 250000 kms
Muchas gracias amigos por permitir compartir nuestras esxperiencias , buenas y malas... La mia hoy es mala, les cuento, funcionaba perfecto , sin falolas de ningun tipo. En eso , se para el motor y al darle con la llave de arranque en el tablero no aparece ninguna funcion, pero el candado aparece cerrado y titilando, el resto de las funciones ewlectricas las hace perfectamente , eal girar la llave , esta activa la radio por ejemplo y funcionan el ventilador , es decir , el comando obedece al giro de al llvae, amigos , por donde empiezo?? un abrazo y gracias a todos !!
hace 3 años
Respuestas de la comunidad
Segun mi experiencia el candado tiene que quedar fijo no titilando para que arranque, cuando queda titilando es porque no reconoce la llave de encendido, tienes que esperar hasta que quede fijo, espero que te sirva mi humilde opinion
hace 3 años
Mejor solución  (según GUILLE, el autor del problema) 
Revisa el cable de masa que esta en el chasis cerce de la optica izquierda hay 3 masas separadas una seguro esta cortada o haciendo falso contacto!!!!!!!!!!
hace 3 años
Mejor solución  (según GUILLE, el autor del problema) 
 Ford Ecosport  2006 · 1.4  · 235000 kms
Empecé a ver manchitas de aceite en el depósito del coolant. Supuestamente se reparó y a los días nuevamente aparece el aceite en el depósito. Su ayuda estimados
hace un mes
Respuestas de la comunidad
Si no se lavó el sistema de enfriamiento pueden ser reciduos de aceite de antes de la reparación, hay que cambiarle el anticongelante rojo
hace un mes
Mejor solución  (según Grace, el autor del problema) 
Se limpió bien el sistema pero el aceite que anda en el depósito parece nuevo. :(
hace un mes
Mejor solución  (según Grace, el autor del problema) 
Si es automática puede ser aceite de la transmisión ya que trae 2mangueras en el radiador y tiene fuga
hace un mes
Mejor solución  (según Grace, el autor del problema) 
La caja es mecánica. No es aceite de transmisión, es de motor, tengo el depósito negro porque se ha adherido a las paredes. Si es problema de mangueras estas se pueden cambiar o es necesario cambiar el radiador?
hace un mes
ricardoSe puede hacer una limpieza con agua purificada y algun desengrasante en el lugar del anticongelante y trabajarla asi unos dias,drenar el sistema y volver hacer el procedimiento hasta que el agua purificada salga transparente se drena y se le pone el anticongelante rojo.
hace un mes
Mejor solución  (según Grace, el autor del problema) 
Mejor solución  (según Grace, el autor del problema) 
 Ford Ecosport  2004 · 4.2 2.0 · 150 kms
Bueno resulto ser el coyarin hidraulico pero compre uno tipo generico y en un mes y quince dias comenzo a botar liga de frenos entre la caja y motor sera la calidad de estos repuestos genericos o tenia a caso que cambiar algo mas.
hace un año
Respuestas de la comunidad
El collarin generico debe ser chino ,no sirve , ya lo comprobaste ,si las autopartes originales a veces fallan ,que sera las imitaciones chinas. No mencionas el kilometraje y es muy importante para los servicios,
Si la falla inicial era fuga de liquido,pero funcionaba bien el embrague , estuvo correcto, pero si ya tiene mucho uso ,lo recomendable es cambiar el kit completo que consiste en :plato opresor,disco y collarin.
hace un año
Mejor solución  (según carlosaguzman@hot, el autor del problema) 
Gracias por la respuesta si tiene 150 en kilometraje solo cambie el disco el plato o volante está bastante bien y no lo cambie bueno ahora compre el collarin hidraulico original marca LUK a ver que pasa
hace un año
Mejor solución  (según carlosaguzman@hot, el autor del problema) 
Una pregunta mas se bien que este sistema hidráulico es problemático y delicado sera posible reemplazar este sistema por el collarín normal como el que usa la ecosport 4*4
hace un año
Mejor solución  (según carlosaguzman@hot, el autor del problema) 
No creo , porque cada modelo es diferente en diseño,tamaño y funcion. Aun siendo ford, y ecosport.
hace un año
Mejor solución  (según carlosaguzman@hot, el autor del problema) 
 Ford Ecosport  2015 · 28000 kms
Mensaje Motor averiado en color ambar
hace 5 meses
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Tiene garantia de fabrica. Llevala al distribuidor. Son defectos de CALIDAD de fabrica FORD
hace 5 meses
Mejor solución  (según Juan, el autor del problema) 
 Ford Ecosport  2014 · 1.6 · 30000 kms
Choque mi camioneta y retire el frontal pero el motor no se daño nada pero no llega energía al motor de partida, hice la prueba de paletiar los terminales del motor de partida y si llega energía pero no parte con la llave y no se q hacer la que si llega combustible.
Si alguien puede ayudarme plisss.
hace un año
Respuestas de la comunidad
En la caja de fusibles en el motor esta el reelevador de encendido (starter) revisalo.
hace un año
Mejor solución  (según Jonas, el autor del problema) 
 Ford Ecosport  2013 · 1.6 · 30000 kms
Como puedo hacer el reseteo de la camioneta sin resetador , solo lamnte se se camvio la nasta de super a infinia , nada mas y de hay arraco con ese problema de mal funcionamiento
hace un año
Respuestas de la comunidad
Desconecta la bateria x 5 a 10 minutos y vuelve a conectar firmemente.
hace un año
Mejor solución  (según ramon, el autor del problema) 
 Ford Ecosport  2013 · Kinectic titanium 1.6 · 30000 kms
Tengo una eco kinectic titanium 1,6, 2013 y me prende todo junto (anomalia de funcionamiento de motor, sistema de frenos, y control de tracción), y deja de acelerar, la paro, le doy ok a las indicaciones del tablero, y arranca como si nada, funciona perfecto, y al tiempo me lo vuelve a hacer, a alguien la paso, como lo soluciono, desde ya gracias
hace 2 años
Respuestas de la comunidad
Es tan solo suciedad en el cuerpo mariposa (mariposa de aceleracion) que lo limpien y no toquen absolutamente nada mas , tengo la misma eco titanium 2013...
hace un año
Mejor solución  (según Gugli, el autor del problema) 
 Ford Ecosport  2011 · Free Style · 80000 kms
He adquirido este modelo el 2012 nuevo de casa a un precio de $20,000, pero a los 80,000 kilometros ya tiene estos problemas de la compresion que esta marcando en cada cilindro de izquierda a derecha en 120, 130, 140, 150 PSI respectivamente (lo normal deberia ser sobre 200PSI SEGUN EL MECANICO), lo lleve a la casa y me cotizaron la reparacion en $ 5,000 indicandome que la falla es por el aceite usado lo cual me parece extraño ya que siempre he usado 10W 30 o el 5W 30 el cual es el mismo grado que usan en casa pero aun asi me dijeron que ellos usan una marca especial para sus mantenimientos. Otro mecanico de fuera me cotizo la reparacion en $ 1,500 y me dijo que el motor es muy delicado con el tipo de aceite que usa.
hace un año
Respuestas de la comunidad
La opinion de la agencia es porque no les parece que NO se la lleves a servicio. La opinion del 1er. Mecanico es que quiere sorprenderte que sabe mucho y por eso te quiere cobrar mucho. La realidad un motor con 80,000 km. con los servicios regulares, con aceite que le has puesto esta correcto. Un motor con 100 libras de de compresion ,esta en el rango ,el que dijo que debe tener 200 libras te esta tomando el pelo, igual en las diferencias de presion entre cilindros. El problema del consumo de aceite no mencionas que tanto es. Sin embargo te suguiero que le cambies la valvula PCV (valvula de ventilacion del carter) ya debe de estar defectuosa y acumula presion en el carter con los gases de combustion del motor que no libera,diluyendo el aceite y haciendo que suba el aceite a la camara de combustion quemandolo. La valvula pcv es muy economica y facil de cambiar ,debe de estar en la tapa de punterias,conectada a una manguera a la admision para quemar los gases de combustion de nueva cuenta ,para eficientar el consumo de combustible y evitar contaminacion. Saludos. Desde mexico.
hace un año
Mejor solución  (según Chicho, el autor del problema) 
Hermosa ciudad de Mexico Df he tenido la suerte de estar por alla, gracias por tu respuesta. Referente al consumo de aceite esta entre 1/4 y 1/8 de galon a la semana (300km) en zona urbana ademas bota humo blanco y apesta pero voy a visitar a un segundo mecanico y mencionar tu recomendacion. Gracias nuevamente.
hace un año
Mejor solución  (según Chicho, el autor del problema) 
 Ford Ecosport  2014 · Titanium 2.0 · 35000 kms
Apago al auto y cuando quiero volver a encenderlo me sale el mensaje presión baja del aceite del motor y no prende más, lo dejo una hora y luego prende perfectamente. Ya me lo hizo varias veces.
Fernando Argentina
hace un año
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Tiene garantia de fabrica ,reportalo en la agencia para revision.
hace un año
Mejor solución  (según Fernando , el autor del problema) 
Hola Fernando: a mi me hizo lo mismo, desconecté la batería, volvía aconectarla y arrancó todo ok, llevé a la agencia para control, conectaron la computadora, chequearon todo y no encontraron nada...
hace 6 meses
Mejor solución  (según Fernando , el autor del problema) 
 Ford Ecosport  2005 · 1.4 · 120000 kms
Hace un ruido imprecionante del lado de las poleas, no logro identificar. Sugerencias?
hace 3 años
y otra persona con el mismo problema
Respuestas de la comunidad
Con mi esposo compramos una eco, todo bien hasta que comenzo a realizar un ruido cerca del aire acondicionado, la reviso un especialista y todo bien allí. Le hicimos un cambio de correa de distribución y el ruido apareció en una polea medio hibrida que trae una goma en medio, esa goma se había roto y ese era el ruido; valor de la polea 600.
hace 3 años
Mejor solución  (según Fernando, el autor del problema) 
 Ford Ecosport  2014 · 92000 kms
Iva camino a casa y en departamental , la pantalla del vehiculo muestra que tiene problema en el seguro de pendiente y de repente se paro el vehiculo y no anduvo mas , se bloqueo , no puedo sacar el cambio de park. Me gustaria saber si otra persona a tenido el mismo problema y cual es la solucion.
hace 6 meses
y otras 4 personas con el mismo problema
Respuestas de la comunidad
En el 2011 empezaron a usarlas en el fiesta y focus ,ya la estan montando en todas sus unidades a pesar de presentar multiples fallas y defectos. La transmisión Powershift de Ford es la apuesta de la marca para bajar tanto el consumo de combustible y la emisión de gases contaminantes en sus autos nuevos, más específicamente en los modelos Fiesta y Focus de nueva generación. Esta caja automática robotizada, utiliza la tecnología de doble embrague –o clutch- que también utilizan otras marcas, sólo que ésta es más compacta y ofrece algunas otras ventajas que detallaremos más adelante.
¿Cómo funciona?
Esta parte puede ser un poco tediosa, pero trataremos de hacerlo de la manera más amena posible para describir su funcionamiento. Todas las transmisiones modernas –automáticas o manuales- cuentan con dos trenes de engranes, uno para las velocidades pares (2ª, 4ª y 6ª) y otro para las nones (1ª, 3ª y 5ª). Estos trenes reciben el torque del motor mediante el disco del volante inercial (que a la vez está conectado al cigüeñal que a su vez recibe el impulso de los pistones) pero para cambiar entre un tren y otro, el embrague separa momentáneamente un tren para engranar el otro. Esta tarea se puede realizar mecánicamente (transmisiones manuales), hidráulicamente (transmisiones automáticas convencionales) o eléctricamente (transmisiones robotizadas) pero al contar con un solo clutch o embrague, la tarea es más lenta. Aquí es donde las transmisiones de doble embrague entran en acción pues al tener un embrague para cada uno de los trenes se pueden separar las tareas de desacoplamiento y acoplamiento para cada uno de ellos, logrando que los cambios sean prácticamente instantáneos. La forma en que lo hace es la siguiente: suponiendo que el auto arranca en primera velocidad, el usuario acelera hasta que el motor llega a un determinado número de rpm (dependiendo de la situación y cuánto está presionando el conductor el pedal del acelerador, pueden ser más o menos revoluciones por minuto del motor), entonces la computadora manda la señal a los motores eléctricos de la transmisión Powershift y al mismo tiempo que el clutch para las velocidades nones (1ª, 3ª y 5ª) desacopla el tren de éstas, el otro embrague acopla el tren de las velocidades pares (2ª, 4ª y 6ª). Todo esto sucede en fracciones de segundo así que el motor prácticamente se mantiene en la misma curva de torque y no tiene que volver a empezar desde abajo para recuperar el impulso. Esto se traduce en un mejor aprovechamiento de la energía del motor, un menor consumo de combustible y menor producción de gases contaminantes.
Otras ventajas de esta transmisión son las siguientes:
-Gracias al diseño compacto y a la falta de sistema hidráulico, la Powershift ahorra 70 kg en el peso total del auto (menos componentes y menos fluidos). -La caja es más compacta gracias a los actuadores electromecánicos que sustituyen a los hidráulicos para mover los trenes de velocidades, esto le permite ocupar menos espacio bajo el cofre y acomodar más fácilmente los demás componentes del motor. -La transmisión viene sellada de fábrica, gracias a que el único fluido que contiene es el que lubrica la parte interna, además los actuadores que mueven los trenes de velocidades son eléctricos convirtiéndola en una transmisión libre de mantenimiento por hasta 10 años. -Gracias a que los embragues son controlados por una computadora y no por un humano, la vida de las pastas se prolonga mucho más, así que el clutch se cambia cada 10 años en un escenario óptimo.
Como todo, también existe un lado negativo o por lo menos algunos detalles que se podrían traducir por el usuario como fallas o comportamientos extraños. Éstos son algunos de ellos y sus causas:
-Al ser una transmisión manual robotizada, Powershift no cuenta con fluido hidráulico para su funcionamiento, sólo el aceite que lubrica internamente, entonces los ruidos que se producen al acoplar y desacoplar las velocidades se hacen más evidentes. En una transmisión automática convencional, el fluido y el mismo sistema aíslan estos ruidos. -Al apagar el motor, la transmisión tiene que prepararse para cuando el auto se vuelva a encender, así que en algunas ocasiones se pueden escuchar ruidos de la transmisión aunque el motor se haya apagado. No es ninguna falla, sino que la Powershift se está moviendo internamente para quedar en una posición ideal para el arranque. -Como su accionamiento es más parecido al de una transmisión manual que al de una automática convencional, la Powershift de Ford puede provocar que el auto se mueva hacia atrás cuando el freno no se aplicó y el sistema de ayuda en pendientes no frenó el auto, tal como lo pasaría con una caja manual. Es cuestión de acostumbrarse pues bajo ninguna circunstancia el auto avanzaría mucho, antes el sistema entra en acción y engrana la primera velocidad o la reversa según sea el caso.
Ford está continuamente trabajando para mejorar el funcionamiento de la Powershift y aislar los ruidos que se producen durante los cambios o los raros casos en los que se llega a calentar el sistema. Aproximadamente, dos o tres veces al año se realizan ajustes en la programación de la computadora de la transmisión y cada que el usuario lleva su auto a la agencia para servicio, se actualiza el software de la transmisión a la versión más reciente. Son defectos de diseño de transmisiones de fabrica de ford. Que no termina de perfeccionar, por lo que aumento a 10 años de garantia. Llevalo al distribuido ford
hace 6 meses
VerónicaRicardo! Excelente aportación, sólo que te quedaste corto en el lado negativo de la Powershift... Yo tengo una Ecosport y era muy Feliz con ella, pero de los 20,000 kms en adelante las velocidades empezaron a "patinarse". En menos de un año -supuestamente- cambiaron 2 veces el embrague; en menos de un mes la dejé dos veces en la agencia, por un código de error que marcaba, pues después de varios intentos para encenderla, daba marcha... Según fue el Módulo de la Transmisión... en fin... quedé decepcionada...
Espero que muy pronto FORD perfeccione la Power Shift...
hace 2 meses
Mejor solución  (según darwin, el autor del problema) 
ricardoMas bien que los consumidores dejen ce comprar sus vehiculos defectuosos de fabrica, por solo fijarse en el diseño vistoso sin la calidad requerida por la alta inversion economica que se hace. Saludos desde chetumal q roo.
hace 2 meses
Mejor solución  (según darwin, el autor del problema) 
VerónicaMuy cierto Ricardo! pero años atrás FORD era muy bueno... en realidad como todo, aveces las innovaciones no son muy buenas!...
En tu opinión, qué auto recomiendas?... Saludos desde La Ciudad de México.
hace 2 meses
Mejor solución  (según darwin, el autor del problema) 
ricardoDe que segmento : sub-compacto, compacto, mini-suv, suv ,ETC.
hace 2 meses
Mejor solución  (según darwin, el autor del problema) 
VerónicaSub-compacto, compacto y suv...
hace 2 meses
Mejor solución  (según darwin, el autor del problema) 
ricardoLos toyotas yaris sedan hecho en japon, el corolla hecho en canada, sienna hecha en EE.UU. en la famila tenemos los 2 primeros , excelentes vehiculos , no puedo opinar de los hechos en mexico, brasil, tailandia, turquia , malasia sea de la marca que quieras , entra a la pagina ahi encontraras marcas ,modelos , las fichas tecnicas ,equpamientos y precios de las diferentes marcas , en las que puedes hacer compartivas entre si y ver que vehiculo te convence mas.
hace 2 meses
Mejor solución  (según darwin, el autor del problema) 
Mejor solución  (según darwin, el autor del problema) 
 Ford Ecosport  2007 · 2.0 · 213000 kms
Hola, nuevo por aqui... cuando quiero cambiar a la velocidad quinta, no entra, hace como un chillido o ruido , y no entra la quinta.
A que se debera eso? sera que debo cambiarle el aceite de caja ?
El pedal de croche lo siento bien. }

Que tipo de aceite de caja usa mi ecosport motor 2.0 sincronica año 2007
A GILVenezuela
hace un año
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Hay que revisar primero el varillaje del selector de velocidades ,puede estar desajustado.
hace un año
Mejor solución  (según A GIL, el autor del problema) 
Ok... y que tipo de aceite usa para la caja ?
hace un año
Mejor solución  (según A GIL, el autor del problema) 
Full syntetic
Transmisión fluid
Gt = sae75w-90
Premium synthetic
hace un año
Mejor solución  (según A GIL, el autor del problema) 
 Ford Ecosport  2006 · 1.6 · 17000 kms
Cuando circulaba sin dificultad marco en el tablero el agua y subió la temperatura demoro en encender el electro ventilador y cuando comenzó a funcionar no bajo la temperatura. Ahora anda el ventilador y tira el agua por el deposito, el agua hervida.
Rosa Salta CapitalArgentina
hace un año
y otra persona con el mismo problema
Respuestas de la comunidad
Revisa el termostato ,no debe de estar abriendo oportunamente, sensor de temperatura,radiador y mangueras.
hace un año
Mejor solución  (según Rosa Salta Capital, el autor del problema) 
Me sucede el mismo problema pero donde encuento el sensor de temperatura, y si el ventilador es controlado por la computadora, es aparte a la computadora
hace 10 meses
Mejor solución  (según Rosa Salta Capital, el autor del problema) 
El sensor de temperatura esta en la caja del termostato y es el que controla el encendido del ventilador
hace 10 meses
Mejor solución  (según Rosa Salta Capital, el autor del problema) 
 Ford Ecosport  2007 · 4 puertas,motor 1.6 · 100500 kms
Se desprendió la bobina y se quedó sin los 4 tornillos que la soportan, cayendo arriba del múltiple de escape, al parecer, explotó la bobina, pero quisiera saber porque no tiene contacto o swe quedó sin contacto ya que tengo un vidrio bajo y no lo puedo subir por la falta del contacto...luces, estereo y demas accesorios prenden, pero no funciona el es problema de bateria...
hace un año
y otra persona con el mismo problema
Respuestas de la comunidad
Cuando hay un fallo asi en el encendido, la computadora por seguridad bloquea varios servicios. Hay unos modelos de ford que traen un boton de emergencias,que en caso de accidente,automaticamente bloquea combustible y corriente , para evitar un incendio.
hace un año
Mejor solución  (según german, el autor del problema) 
 Ford Ecosport  2005 · XLS 1.6 · 103000 kms
Veo que en el motor de la eco cuando está trabajando a 800RPM o en reposo con el motor encendido veo que el motor está vibrando mucho fuera de lo normal
hace 2 años
y otra persona con el mismo problema
Respuestas de la comunidad
Saludos Wersick,hay una serie de variable que hay que considerar,1ro,chequeate las base del motor,2do. Chequeo de bujías y cables,3ro válvula IAC, y filtro de aire,
hace 2 años
Mejor solución  (según Wersick, el autor del problema) 
 Ford Ecosport  2006 · 4x2 2.0cc mecanico · 160000 kms
Cuando voy en la velocidad 5ta. A 90 KM x hora no desarrolla el velocimetro ya no avanza por mas que piso el acelerador hace fuerza en desarrollar que puedo hacer si ya cambie el disco, plato y cilindro de embrague
hace 4 años
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2014 · SE · 55000 kms
No entra primera , 2,3,4ta si pero forzadas y marcha atras se queda trabada. Si apago el motor los cambios entran con normalidad. No patina el embrague , tiene pique. Con 55.000km
hace un mes
Respuestas de la comunidad
Puede tener aire el sistema de embrague, hay que purgarlo bien.
hace un mes
Mejor solución  (según joak, el autor del problema) 
Lo lleve a la concesionaria me dijeron que el sistema hidráulico esta bien sin perdidas ni aire , lo van a desarmar para ver si es el embrague. Si esta gastado me cobran $$ si es otra cosa entra en garantía. Incomparable!! ya veo que me cobran y fue.
hace un mes
Mejor solución  (según joak, el autor del problema) 
 Ford Ecosport  2006 · 4 puertas 1.5 diesel duratorq · 219882 kms
Hola... me veo en la necesidad de escribir por qe tuve tengo un problema con el encendido del motor la semana pasada la lleve al electrisista por qe sonaba el arranque pero no encendia y me la dejaron andando y me dijo qe era un problema en el automatico del encendido ya que tenia los carbones del arranque nuevos... quedo andando perfecto pero ayer no la pude encender no suena el arranque aunque tiene la bateria recien nueva... que puede estar fallando?
aldo mazaArgentina
hace 5 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Tampoco emite sonidos al darle arranque como si no llegara la señal
hace 5 meses
Mejor solución  (según aldo maza, el autor del problema) 
Si prenden todos los testigos del tablero revisa terminales de bateria si estan ok, el fusible y el reele de encendido (starter) esta en al caja de fusibles en el motor, en la tapa esta la ubicacion y servivio
hace 5 meses
Mejor solución  (según aldo maza, el autor del problema) 
 Ford Ecosport  1999 · 1364 kms
Se calienta en motor y queda sin agua el auto es un ford euroescort glx 1-6 año 1999 espero su ayuda gracia saludos cordiales espero respuesta a mi correo elecpcm2@gmail-com gracias
hace 6 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Si no tiene fuga de anticongelante , revisa si no se esta fugando al carter y el aceite del motor esta lechoso.
hace 6 meses
patricioNO pasa el agua al aceite yo creo que puede ser la bomba del agua sera posible gracias
hace 6 meses
Mejor solución  (según patricio, el autor del problema) 
Mejor solución  (según patricio, el autor del problema) 
 Ford Ecosport  2012 · 5 puertas 2.0xlt · 60000 kms
Lei el manual y es la admision de gases, me dicen que necesito cambiar una valvula, me piden 1400 $, puede ser? alguien me puede ayudar a ver si lo puedo reparar yo?
hace 2 años
Respuestas de la comunidad
Acá en México hay una cadena de tiendas llamada Autozone donde te revisan sin costo con escáner las fallas del auto cuando tienen prendidas la lamparas de "check engine" y te puede guiar para conocer la falla. En ocasiones hay una falla de adminision de gases cuando se llena el tanque de gasolina estando el motor encendido, asi que revisa que código de falla es exactamente. Si no tienes cómo conocer el código, tendrás que pagar para que lo hagan y conocer el problema.
hace 2 años
Mejor solución  (según oscar, el autor del problema) 
Esta fallando la sonda lambda o el catalizador de gases. Es muy,muy caro.
hace 2 años
Mejor solución  (según oscar, el autor del problema) 
 Ford Ecosport  2007 · motor duratec ,2.0 motor 4 en linea · 186000 kms
Bueno la camioneta enciende bn pero se apaga hay acelerarla para que se mantenga encendida pero esto sucede solo con el motor frio cuando esta caliente desaparece la falla
omar2274 Venezuela
hace 2 años
Respuestas de la comunidad
Mi eco 1.6 en frio o caliente , en baja se apaga. No permanente pero con frecuencia.
hace 2 años
Mejor solución  (según omar2274 , el autor del problema) 
Mi Eco 1.6 con GNC, con motor frío o caliente , se desacelera y se para. No siempre, pero con frecuencia. Si alguien puede aportar algo, dsd ya muchas gracias.
hace 2 años
Mejor solución  (según omar2274 , el autor del problema) 
 Ford Ecosport  2006 · motor 1.6 · 0 kms
Buenos días, Escribo en esta pagina para obtener ayuda y saber que hacer. Les cuento que el fin de semana en un tranque tuve problemas con mi ford me estacione en en una bomba y cuando abro la tapa del motor estaba echando humo y olía como aceite quemado pues deje que se refrescara medí el aceite y estaba casi seco y tampoco tenia agua. Pues le eche al motor en el momento aceite y agua y pues con un poco de fallo en el carro llegue rápido a casa y llego igual echando humo de motor. Al día siguiente lo verifique y me percate que el tanque del radiador se había roto, el mismo radiador también te…Leer completa
Urbano FernandezPanamá
hace 10 meses
Respuestas de la comunidad
Desde el 1er. - recalentamiento se quemo el empaque de la culata al quedarse sin aceite y refrigerante.
Hay que revisar si no se fisuro la culata , si esta bien hay que llevarla a rectificacion , asentar valvulas, empacar de nuevo y armar.
hace 10 meses
Mejor solución  (según Urbano Fernandez, el autor del problema) 
 Ford Ecosport  2016 · full, motor 1.6 · 3200 kms
Hola Buenas, tengo una ford ecosport hace dos meses, comprada nueva, y hoy me tiro esa falla, no lo pude arrancar, es la version titanium con boton de encendido, y cada vez que intentaba arrancar me salia el mensaje de presion de aceite de motor baja, que me detenga con cuidado, esto me paso al arrancar el vehiculo, poner marcha atras y se apago completamente, funciona todo el tablero solo esa es la falla, a que se debe??
hace un año
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Son defectos de fabrica FORD ,tiene garantia ,llevala al distribuidor.
hace un año
Mejor solución  (según Sebastian, el autor del problema) 
 Ford Ecosport  2005 · 4 puertas, motor 2.0 · 18000 kms
Buen día, le cambie ttodos los soportes del motor y vibra ahora, amortiguadores están nuevos, recién alineada antes de cambirá los soportes. Yo mismo cambie los soportes Sin problema.
hace 2 años
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Puede que los soportes sean muy duros o que este apollando en alguna parte de la carroceria y no te das cuenta.
hace 2 años
Mejor solución  (según profe, el autor del problema) 
 Ford Ecosport  2006 · ecosport 4 cil · 106000 kms
Al dar el llavaso la primera vez fria caliente o como este y no arranca tengo que darle muchisima marcha y acelerarle asta al fondo y arranca pero vibra todo el motor y hace un ruido de matraca y se le quita. Ayudenme por favor amigos ya stoy desesperado
hace 3 años
Respuestas de la comunidad
Me paso lo mismo iba andando el vehículo y se sacudía con falla , la luz de la llave de seguridad encendía intermitente mente , la estaciones para chequear algún desperfecto que pudiese visualizar y opte por recertear la computadora por el borne de la batería y logre llegar sin problemas a la casa pero me tiene curioso la falla
hace 3 años
Mejor solución  (según licenciado, el autor del problema) 
 Ford Ecosport  2007
Con solo 25000 km ya pierde abundante aceite por reten del motor. Muy ruidosa. A 100 km/h practicamente la radio no se puede escuchar y menos mantener unaconversacion.
usuario anónimoArgentina
hace 8 años
y otra persona con el mismo problema
Respuestas de la comunidad
Fijate la alineacion de la tira del año escape - soporte - gomas y demas
hace un año
Mejor solución  (según Anónimo, el autor del problema) 
 Ford Ecosport  2010 · 133 kms
Puede ser q se apaga el motor o no regula q sea la bobina
hace 6 meses
y otras 3 personas con el mismo problema
Respuestas de la comunidad
Revisa la valvula iac (valvula de aceleracion minima) esta oculta detras del multiple, puede estar sucia ,se lava con limpiador w 40 , si no mejora hay que cambiarla por otra original.
hace 6 meses
FabianHola necesito ayuudaaaa urgente necesito saber que sera porque no le cargue nafta tengo una ford ecosport y ahora no arranca mas y no se que sera me podrian ayudaar urgenteeee
hace 6 meses
Mejor solución  (según tincho, el autor del problema) 
EiverSi no suenq la bomba revise el fusible,el relay,o el interructor de corte de combustible ubicado debajo del tablero de instrumentos lado del pasajero
hace 5 meses
Mejor solución  (según tincho, el autor del problema) 
Mejor solución  (según tincho, el autor del problema) 
Al conectar la llave en ON (sin encender ) se escucha el zumbido de la bomba de gasolina ? si no se escucha revisa le fusible y el reele de la bomba de gasolina que esta en la caja de fusibles en el motor, en la tapa esta la ubicacion y servicio.
hace 6 meses
Mejor solución  (según tincho, el autor del problema) 
 Ford Ecosport  2013 · motor 1.6 duratec · 65000 kms
No anda a mas de 100 km por hora para prender tengo q pisar embrague y freno a la vez
omar nicolasArgentina
hace 2 años
y otras 3 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2008 · 188000 kms
Estoy usando aceite 15/40 semisintetico. Esta consumiendose no se ve ningun bote ni rastro. Deberia cambiar de aceite ? La camioneta tiene 188.000 km.
hace 7 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Ese aceite es inadecuado , al haber mala lubricacion se calienta y consume. Ese motor lleva aceite multigrado segun ford 5w 30 en clima templado y 5w 40 en clima calido, no importando el kilometraje.
hace 7 meses
Mejor solución  (según Luis, el autor del problema) 
El aceite que utilizan de fabrica es el 5w30 y 10w30 pero el que estas utilizando aplica debido al kilometraje que tienes si no es mucho el consumo puede ser la marca de aceite que estas utilizando o las gomitas de valvula verifica si humea cuando enciendas en frio en la mañana
hace 6 meses
Mejor solución  (según Luis, el autor del problema) 
Deberia cambiar de aceite de mi ecoesport 1600cc/ año 2006, que aceite tendría que poner , el kilometraje esta en 117.000, gracias por la ayuda.
hace 5 meses
Mejor solución  (según Luis, el autor del problema) 
 Ford Ecosport  2013 · Freestyle full · 1000 kms
Cada vez que enciendo el AC se siente un sonido como de fierros que rozan entre sí como un chirrido y luego empieza a retenerse el vehiculo en marcha, incluso llega a apagarse, pero cuando no uso el AC funciona a la perfección, lo he llevado al Taller de Ford (ya que obviamente se encuentra aún en garantía) y me han indicado que efectivamente tiene una falla y que la va a cubrir la garantia, aún no me han entregado mi camioneta y tampoco han especificado bien la falla, A alguien le ha pasado con un vehículo nuevo?, el mio tiene apenas poco mas de un mes de uso.
hace 3 años
Respuestas de la comunidad
A mi me paso algo pareceido, se debio a que dejaba el aire encendido cuando apagaba la camioneta y al encenderla prende de golpe y daña el croche del compresor... una vez iba a 170 kph y prendi el aire de golpe y lo vole completico...
hace 3 años
Mejor solución  (según LuzPerú, el autor del problema) 
Si estas en lo cierto amigo y bueno Luz eso es por experiencia que ya el croche de compresor de aire no tiene pasta y esta en el hierro pelado tienen que hacerle el cambio saludos
hace 3 años
Mejor solución  (según LuzPerú, el autor del problema) 
Lo mejor para usar el aire es primero encender la camioneta y después el aire, y si estas en ruta es mejor bajarle las revoluciones para prender el aire sino se quema el compresor y hay que cambiar todo
hace 3 años
Mejor solución  (según LuzPerú, el autor del problema) 
 Ford Ecosport  2009 · 165800 kms
Mi ecosport es 2009, motor zetecrocan 1.6,es a nafta y gnc, el problema k cuando anda a nafta se viene abajo el motor y lo paso a gnc y alli avanza normal.
hace 4 meses
Respuestas de la comunidad
Le comente el problema a un mecanico y me dijo k podia k LA SONDA LAMBDA, no esta funcionando correctamente.
hace 3 meses
Mejor solución  (según maykeldez., el autor del problema) 
 Ford Ecosport  2004 · 2.0 · 80000 kms
Cuando el vehículo se calienta se produce un corte eléctrico (me doy cuenta porque se apaga la radio) que ocurre de manera reiterada hasta que se apaga el motor. Siempre que ocurre se enciende el candado y la llave rojas en el tablero que creo que corresponden al encendido.
Muchas de las veces se produce justo cuando se enciende el ventilador, pero solo cuando llevo un buen rato en un taco por lo que el motor esta caliente, sin embargo a veces el ventilador ni siquiera enciende y se produce igual. Esto nunca pasa cuando esta frio solo en caliente.
hace 2 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2006 · motor 2.0 · 142000 kms
Hola, tengo una Eco mod. 2006. Cuando salgo a la ruta despues de unos km me deja de funcionar el embrague ( se pone blando el pedal y no corta). Lo raro es que cuando ando en la ciudad , el embrague funciona bien. No pierde liquido, le hice cambiar la bomba, esta bien purgado... no se que hacer... ayudaaaaaaa
hace 2 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2007 · 4 ptas full, motor 2.0 2007 · 100000 kms
Falla de aceleracion, en motor 2.0. Ecosport 2007
hace 3 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2011 · 4 puertas motor 2.0  · 80000 kms
Al ir circulando despues de media hora de trayecto se prendio una alarma es la imagen de un motor
hace un año
Respuestas de la comunidad
Llevala a escanear a un autozone es sin costo.
hace un año
Mejor solución  (según Jacobo, el autor del problema) 
Gracias la lleve a escanear y solo se relleno el tanque de refigerante del motor y le resetearon la alarma y listo
hace un año
Mejor solución  (según Jacobo, el autor del problema) 
 Ford Ecosport  2006 · 1.4 tdi · 85000 kms
El motor da 3/4 de giro y se clava , tendra algun fusible mecanico ? la correa esta a punto
hace 2 años
Respuestas de la comunidad
A mi tambien se me clavaba pero solo en caliente,era la bobina del burro
hace 2 años
Mejor solución  (según javier, el autor del problema) 
Puede pasar que al volcar el aceite del motor se descarga el la ventilacion hacia el multiple de admision y haya entrado al cilindro
hace 2 años
Mejor solución  (según javier, el autor del problema) 
 Ford Ecosport  2003 · 2.0 L 4x2 XLT · 115500 kms
Tengo perdida de aceite todo al rededor de la junta en el motor otro cada cambio de caja es cm q necesita mucha fuerza cuando paso ha segunda o tercera... es cm q se quiere apagar el motor se me jalonea no se q seria y por ultimo las balizas hay ratos q deja de funcionar alguien me puede imformar ?? desde ya gracias.
hace 9 meses
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2015 · 1.5 tdci · 20000 kms
Yendo en viaje habiendo hecho unos 100km aprox se me detuvo el motor de repente, la apagaba y volvia normal otros km y se paraba nuevamente razón x la cual decidí volverme. Ayer le pasaron el scanner 2 veces y está perfecta y hasta ahora no lo volvió a hacer. Sigo preocupado y me intriga que puede haber sucedido. Unos me dicen la bateria pero está bien y es de 65, ahora pregunto, es diesel, transitaba con aprox 7º bajo cero, es posible que se haya congelado el diesel?
hace 9 meses
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2010 · XLT Plus 2.0 · 200000 kms
Estimados, como si fuese de película, hoy intento encender el motor de mi Eco pero nada. Verifico sistema de encendido y está bien. Por lo que puedo entender hay un problema de combustible porque piso el acelerador y ni siquiera hay indicios de "ahogarse". Es evidente que no llega combustible...
Espero haberme hecho entender. Si me dan una mano...agradecido
hace un año
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2004 · 1. 4 diésel full 4 puertas  · 130000 kms
Hola, tengo una eco 2004 diésel full 1. 4 hace unos meses se paró el motor tal sí se hubiera quedado sin gasolina. La lleve al mecánico y desde ahí no levanta revoluciones el motor por un rato luego cuando levanta saltan las mangueras del retorno de combustible. Nadie sabe que pude ser. Le he cambiado cuanto repuesto me han dicho...
hace un año
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2012 · 4 puertas,full,1.6 · 50000 kms
Tengo una eco 2012, linea vieja empeze a tener problemas con el motor fallaba ,y lo lleve al mecánico ,desarmo y nos encontramos en el cilindro cuatro ,q los aros estaban pegados ,es normal lo q paso o ai solamente ,el mecánico me dice q los aros estaban armados mal ,estaban la abertura de los aros en la misma linea ,puede ser eso o una mala lubricación ,espero la repuesta de algún entendido gracias
hace 2 años
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2004
Una porquería la ecosprt. Le tuve que hacer motor a nuevo despues de 80.000 y la caja de velocidades estaba clavada. Y a Ford no le importa un carajo, no te responden.
usuario anónimoArgentina
hace 9 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2004 · 4 puertas,1.6 · 8000 kms
Necesito saber porque tengo la temperatura normal en el tablero, pero yo siento el motor muy caliente y veo que demora el electro en encender,y necesitaria saber por que se corta el electro cuando paro el motor estando caliente.
hace 2 años
Respuestas de la comunidad
Si el reloj de temperatura está normal y el electroventilador enciende puede ser una suceptibilidad tuya el creer que está prendiendo a destiempo, no me preocuparía por eso. Con respecto a porque se apaga, basicamente porque no tiene sentido que siga encendido ya que la bomba de agua se detiene junto con el motor y el ventilador solo enfriaría el líquido depositado dentro del radiador y no el motor en sí.
hace 2 años
Mejor solución  (según Ruben, el autor del problema) 
Lo prudente quizás sería apagar el motor una vez que el ventilador haya parado
hace 2 años
Mejor solución  (según Ruben, el autor del problema) 
Compre una eco año 2007 turbodiesel, me arrepiento, siempre fui fanatico de FORD, pero nunca mas les compro un auto, me gaste fortuna en la eco y no anda, lo peor de lo peor-tel.0342-155261780
hace 2 años
Mejor solución  (según Ruben, el autor del problema) 
 Ford Ecosport  2004 · 210000 kms
Cuando pongo en marcha el motor de mi auto y avanzo cuando el motor aun esta frio se tironea pero si piso el embrague lo deja de hacer; esto solo sucede en las velocidades bajas y después de que le motor se calienta.
hace 2 días
Respuestas de la comunidad
Revisa el sensor tps ,esta en el cuerpo de aceleracion.
hace 2 días
Mejor solución  (según Edgar, el autor del problema) 
 Ford Ecosport  2006 · 1.4  · 235000 kms
Hola, liguen buzo que haya hecho un cambio de motor a este carro, qué motor me recomiendan? Y que inconvenientes tuvieron luego del cambio :/
hace 3 días
Respuestas de la comunidad
Mi motor se desvielo por culpa del mecanico ya que me movio la cadena de tiempo y pues es mucho el gasto, es mejor recomendable comprar otro motor
hace 2 días
Mejor solución  (según Grace, el autor del problema) 
 Ford Ecosport  2015 · 12000 kms
Pare la ecosport y se encendio el mensaje ptesion alta del aceite del motor. Prendi a los 5 m8nutos y arranco normalmente. Estoy preocupado por que tengo un viaje de 9 horas que debo hacer. La 3co me trajo problemas desfe que compre. No aconsejo comprar este vehiculo
hace 2 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Tiene garantía. De fábrica. Llévala. Al distribuidor ti eñes toda l a razon. Traen muchos defectos
hace un mes
Mejor solución  (según Josr, el autor del problema) 
 Ford Ecosport  2013 · 77000 kms
Es en las mañana en el primer arranque le doy arranque y no ase nada me pide apretar freno luego embrague arranca pero no acelera luego la apago por k me dice falla de motor la vuelvo a encender y sele va la falla si alguien sabae k me avise 1134130816
hace 2 meses
Respuestas de la comunidad
Fijate las bujías en que condiciones están. A mi me aparecía la luz testigo del motor mientras andaba y era problema de las bujías.
hace 2 meses
Mejor solución  (según Leandro, el autor del problema) 
 Ford Ecosport  2016 · 13 kms
Porque el velntilardor del radador se enciende rapido y no tengo un sesnor activdo
hace 2 meses
Respuestas de la comunidad
Tiene garantia de fabrica ,llevalo a la agencia.
hace 2 meses
Mejor solución  (según toño, el autor del problema) 
 Ford Ecosport  2008 · 5 puertas · 160000 kms
Hola empezó a vibrar el motor no tiene velocidad se apaga y lanza un humo blanco por favo si alguien me puede ayudar gracias!!!
hace 3 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Debe estar fugando el anticongelante a la camara de combustion por empaque de culata, por eso el humo blanco. Observa de disminuye el nivel de anticongelante en el deposito de retorno.
hace 3 meses
Mejor solución  (según yamila, el autor del problema) 
 Ford Ecosport  2016 · TITANIUM · 34000 kms
Xq me aparece motor averiado recien lo hice un service completo y cuando lo di arranque aparecio eso que es? no entiendo
hace 4 meses
y otras 3 personas con el mismo problema
Respuestas de la comunidad
En el 2011 empezaron a usarlas en el fiesta y focus ,ya la estan montando en todas sus unidades a pesar de presentar multiples fallas y defectos. La transmisión Powershift de Ford es la apuesta de la marca para bajar tanto el consumo de combustible y la emisión de gases contaminantes en sus autos nuevos, más específicamente en los modelos Fiesta y Focus de nueva generación. Esta caja automática robotizada, utiliza la tecnología de doble embrague –o clutch- que también utilizan otras marcas, sólo que ésta es más compacta y ofrece algunas otras ventajas que detallaremos más adelante.
¿Cómo funciona?
Esta parte puede ser un poco tediosa, pero trataremos de hacerlo de la manera más amena posible para describir su funcionamiento. Todas las transmisiones modernas –automáticas o manuales- cuentan con dos trenes de engranes, uno para las velocidades pares (2ª, 4ª y 6ª) y otro para las nones (1ª, 3ª y 5ª). Estos trenes reciben el torque del motor mediante el disco del volante inercial (que a la vez está conectado al cigüeñal que a su vez recibe el impulso de los pistones) pero para cambiar entre un tren y otro, el embrague separa momentáneamente un tren para engranar el otro. Esta tarea se puede realizar mecánicamente (transmisiones manuales), hidráulicamente (transmisiones automáticas convencionales) o eléctricamente (transmisiones robotizadas) pero al contar con un solo clutch o embrague, la tarea es más lenta. Aquí es donde las transmisiones de doble embrague entran en acción pues al tener un embrague para cada uno de los trenes se pueden separar las tareas de desacoplamiento y acoplamiento para cada uno de ellos, logrando que los cambios sean prácticamente instantáneos. La forma en que lo hace es la siguiente: suponiendo que el auto arranca en primera velocidad, el usuario acelera hasta que el motor llega a un determinado número de rpm (dependiendo de la situación y cuánto está presionando el conductor el pedal del acelerador, pueden ser más o menos revoluciones por minuto del motor), entonces la computadora manda la señal a los motores eléctricos de la transmisión Powershift y al mismo tiempo que el clutch para las velocidades nones (1ª, 3ª y 5ª) desacopla el tren de éstas, el otro embrague acopla el tren de las velocidades pares (2ª, 4ª y 6ª). Todo esto sucede en fracciones de segundo así que el motor prácticamente se mantiene en la misma curva de torque y no tiene que volver a empezar desde abajo para recuperar el impulso. Esto se traduce en un mejor aprovechamiento de la energía del motor, un menor consumo de combustible y menor producción de gases contaminantes.
Otras ventajas de esta transmisión son las siguientes:
-Gracias al diseño compacto y a la falta de sistema hidráulico, la Powershift ahorra 70 kg en el peso total del auto (menos componentes y menos fluidos). -La caja es más compacta gracias a los actuadores electromecánicos que sustituyen a los hidráulicos para mover los trenes de velocidades, esto le permite ocupar menos espacio bajo el cofre y acomodar más fácilmente los demás componentes del motor. -La transmisión viene sellada de fábrica, gracias a que el único fluido que contiene es el que lubrica la parte interna, además los actuadores que mueven los trenes de velocidades son eléctricos convirtiéndola en una transmisión libre de mantenimiento por hasta 10 años. -Gracias a que los embragues son controlados por una computadora y no por un humano, la vida de las pastas se prolonga mucho más, así que el clutch se cambia cada 10 años en un escenario óptimo.
Como todo, también existe un lado negativo o por lo menos algunos detalles que se podrían traducir por el usuario como fallas o comportamientos extraños. Éstos son algunos de ellos y sus causas:
-Al ser una transmisión manual robotizada, Powershift no cuenta con fluido hidráulico para su funcionamiento, sólo el aceite que lubrica internamente, entonces los ruidos que se producen al acoplar y desacoplar las velocidades se hacen más evidentes. En una transmisión automática convencional, el fluido y el mismo sistema aíslan estos ruidos. -Al apagar el motor, la transmisión tiene que prepararse para cuando el auto se vuelva a encender, así que en algunas ocasiones se pueden escuchar ruidos de la transmisión aunque el motor se haya apagado. No es ninguna falla, sino que la Powershift se está moviendo internamente para quedar en una posición ideal para el arranque. -Como su accionamiento es más parecido al de una transmisión manual que al de una automática convencional, la Powershift de Ford puede provocar que el auto se mueva hacia atrás cuando el freno no se aplicó y el sistema de ayuda en pendientes no frenó el auto, tal como lo pasaría con una caja manual. Es cuestión de acostumbrarse pues bajo ninguna circunstancia el auto avanzaría mucho, antes el sistema entra en acción y engrana la primera velocidad o la reversa según sea el caso.
Ford está continuamente trabajando para mejorar el funcionamiento de la Powershift y aislar los ruidos que se producen durante los cambios o los raros casos en los que se llega a calentar el sistema. Aproximadamente, dos o tres veces al año se realizan ajustes en la programación de la computadora de la transmisión y cada que el usuario lleva su auto a la agencia para servicio, se actualiza el software de la transmisión a la versión más reciente. Son defectos de diseño de transmisiones de fabrica de ford. Que no termina de perfeccionar, por lo que aumento a 10 años de garantia. Llevalo al distribuido ford
hace 4 meses
Mejor solución  (según NEUSAN, el autor del problema) 
 Ford Ecosport  2010 · 40000 kms
Se prende la luz amarilla del tablero del check del motor
hace 4 meses
y otra persona con el mismo problema
Respuestas de la comunidad
Modo de Autocomprobación, para pasar al modo de autocomprobación del cuadro de instrumento haga lo siguiente:

1. Pulse y mantenga pulsado el botón de puesta a cero del cuentakilómetros parcial (RESET) y, a continuación, ponga el contacto en la posición II ó III.
2. Suelte el botón de puesta a cero del cuentakilómetros parcial cuando aparezca TEST en la pantalla de cristal líquido (LCD). Esto tarda entre cinco y ocho segundos. 3. El cuadro de instrumentos realiza la prueba de potenciómetro del indicador.4. Para pasar a las siguientes pruebas mientas se está en el modo de autocomprobación, pulse el botón de puesta a cero (RESET).5. La autocomprobación se desactiva cuando se desconecta el contacto (OFF). Un consejo: Cuando leas la palabra DTC en la pantalla, debe poner NONE, si pone algun numero es q hay algun tipo de error.
hace 4 meses
Mejor solución  (según Gaby, el autor del problema) 
 Ford Ecosport  2005 · 2.0 4x2 · 145690 kms
Hola amigos tras la armada reciente del motor después de ser anillado mi ecosport no tiene fuerza el primer cilindro no funciona y al llegar a 3000 revoluciones pareciera que tengo una matraca tracacacacacacacacacacacacacacacacaacacacacacacacacacacaca alguien que me de su opinion por paso el mecánico se convirtió en mago... desapareció el desgraciado...
hace 6 meses
Respuestas de la comunidad
Valvulas de la tapa de compresion enciende el motor y trata de tapar con un carton el escape si succiona el carton tienes problemas con las valvulas
hace 6 meses
Mejor solución  (según irwing, el autor del problema) 
 Ford Ecosport  2013 · New, cinco puertas, bencinero, 1.6 · 70000 kms
En tres ocasiones me ha ocurrido lo mismo y aún no saben qué es, cuando voy viajando y está lloviendo aparece el mensaje de "motor averiado diríjase a servicio técnico de inmediato", el motor se detiene y no vuelve a encender, he tenido que ser trasladado por grúa las tres veces. En taller sólo me dan diagnósticos informales.
Yovanny ManzoChile
hace 8 meses
Respuestas de la comunidad
Revisa el sensor de cigueñal. Puede estar fisurado y al mojarse apaga el motor.
hace 8 meses
Mejor solución  (según Yovanny Manzo, el autor del problema) 
 Ford Ecosport  2013 · 1,6 · 55000 kms
Hola, me salio este mensaje en mi ford y al pasarlo al scanner dice que es la bobina, pero no encuentro el repuesto en ninguna parte,
Dicen que es muy nuevo para la falla que tiene, quien sabe donde puedo encontrarlo. Soy de Santiago. El auto funciona sin fuerza pero de la nada a veces esta un dia sin tener problemas
hace 9 meses
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Ya revisaron la bateria , si es la original de fabrica ,puede ser que ya no retiene carga y empezo a manifestar fallas
hace 9 meses
Mejor solución  (según Rosa, el autor del problema) 
 Ford Ecosport  2014 · 1.6 16v · 55000 kms
Se encendio una luz testigo en el tablero; en la pantalla dice que tiene averias en el motor
hace 10 meses
Respuestas de la comunidad
Si tiene la bateria original de 45 amps. Debe ser que ya no retiene carga , cuando la cambies consiguela de 75 amps. Y solucionado. Es un defecto de fabrica ford de poner bateria insuficiente para todo el equipamiento que traen.
hace 10 meses
Mejor solución  (según ruben, el autor del problema) 
 Ford Ecosport  2013 · 4 puertas motor 1600  · 65000 kms
Vibra en frío a los dos minutos de haber empezado a funcionar. Luego queda funcionando bien
Luis albertoBolivia
hace 10 meses
Respuestas de la comunidad
Amigos. Poseo un ford ecoesport XLT 2010 y hace 3 dias comenzó a vibrar el auto completo,pero solo un poco tiempo, esto sucedió en la mañana y la tarde cuando vuelvo a la casa. Hasta que hoy no partió. Fvaor enecesito me indiquen que será. Unas personas me indican que pueden ser la Bujias (mal estado) y otros la caja de camio.
PD: La vibración es muy similar a cuando tu sacas el pie del embrague y el auto vibra y tiende a detenerse.
hace 8 meses
Mejor solución  (según Luis alberto, el autor del problema) 
 Ford Ecosport  2014 · Tdci 1.4 · 76889 kms
Lo lleve a concesionario no encuentra la falla no se q podra ser desde ya muchas gracias
hace un año
y otra persona con el mismo problema
Respuestas de la comunidad
Resetealo: desconecta el polo negativo de la bateria y vuelve a conectar firmemente,asi se borra la memoria de la bateria.
hace un año
Mejor solución  (según Nahuel, el autor del problema) 
 Ford Ecosport  2007 · 4 puertas · 180 kms
El motor se enciende bien , pero al dejarlo en neutral se apaga haciendo una o dos explosiones lo acaban de anillar pero es lo que presenta y no le hayo que sera
sr. conradoMéxico
hace un año
Respuestas de la comunidad
Revisa la valvula iac (valvula de aceleracion minima) es la que regula el ralenti (RPM) del motor para que no se apague. Puede estar sucia, se lava con carbuclean. Revisa arnes de conexión y cableado por algun posible falseo.
hace un año
Mejor solución  (según sr. conrado, el autor del problema) 
 Ford Ecosport  2006 · Básica motor 1.6 · 220000 kms
Hola buenas, tengo un eco del 2006 y al darle arranque el motor de partida tiene un ruido raro como que gira pero no parte luego espero un poco le doi de nuevo, a veces funciona a la segunda otras veces a la tercera o cuarta, según yo es el bendix pero no se bien. Gracias
hace un año
y otra persona con el mismo problema
Respuestas de la comunidad
Efectivamente debe de estar patinando el bendix ,hay que cambiarlo ,de lo contrario va a dañar el aro dentadado del motor.
hace un año
Mejor solución  (según Buccadr, el autor del problema) 
 Ford Ecosport  2011 · 1.6 · 115000 kms
Necesito saber por favor si es lo mismo que la moura si son la misma empresa o misma calidad de producto ya que la craff me duro casi 5 años
hace un año
Respuestas de la comunidad
Motorcraft es una empresa de Ford que hace baterias y otros componentes... esa es la "oficial", esto no quita que con las especificaciones de la bateria puedas comprar una de otra marca (por ejemplo Bosch)
hace 3 meses
Mejor solución  (según carlos, el autor del problema) 
 Ford Ecosport  2013 · 1.6 nasta  · 30000 kms
Que hago al reseteo sin mecanico como se hace por favor gracia
hace un año
y otra persona con el mismo problema
Respuestas de la comunidad
Solo desconecta la bateria de 5 a 10 min. Y vuelves a conectar firmemente.
hace un año
Mejor solución  (según ramon, el autor del problema) 
 Ford Ecosport  2012 · 5 PUERTAS · 52000 kms
Al encender la camioneta ecosport hizo un ruido como si se hubiera enredado algo en el ventilador y según el taller se desbarató el motor de arranque. Este daño a qué se debe?Se puede arreglar este motor? o Que debo hacer?
Edel-de IbaguéColombia
hace un año
Respuestas de la comunidad
Hola mi ecosport 2008 4X4 tenia un ruido atras y cambie amortización y bandas de freno y continuaba el ruido y al final era el lápiz
hace un año
Mejor solución  (según Edel-de Ibagué, el autor del problema) 
 Ford Ecosport  2004 · 4 puertas motor 1.6  · 19000 kms
Hola amigos tengo una eco iba en marcha y el pedal del cloche se quedo abajo pensé que era el bombin del pedal y lo cambie...lo monte y a lo que prendí bota liga de frenos x hay que sera ayuda por favor sera el "collarín"
hace 2 años
y otra persona con el mismo problema
Respuestas de la comunidad
Muy buen día,yo tengo este mismo problema, cambie el collarín y luego de 6 meses me dejo botada y según elmecanico es el collarín otra vez...esa pieza se repara?????
hace 2 meses
Mejor solución  (según antonio, el autor del problema) 
 Ford Ecosport  2006 · 1.6 naftera full · 121000 kms
Cuando la compre note que cuando encendía el aire acondicionado las revoluciones bajaban a la mitad de mil vueltas y debía acelerar más de lo normal, el mecánico le cambió la pieza pero ahora regula en 3000 vueltas y no lo puede bajar sin adaptar algo para que lo haga, necesitaría saber te se hace en esos casos, gracias
hace 2 años
Respuestas de la comunidad
Me ocurriò algo similar despuès de un service, me quedò regulando alto. La soluciòn se logrò agrgando un aditivo al combustible para que lubrique la zona donde estar el bendito paso a paso, y luego de unos dias de uso se corrigiò solo.
hace 9 meses
Mejor solución  (según Gustavo36, el autor del problema) 
 Ford Ecosport  2006 · 1.6n naftera con gnc XLS · 122000 kms
Nunca tuve problema con la camioneta , hasta la fecha. Primero tenia problema con la manguera de admisión se zafaba, presuntamente el mecánico me lo arreglo pero al poco tiempo espeso andar acelerada en GNC, y al poco tiempo se espeso a encender el alcahuete del inmovilizador de motor y falla, no sucede lo mismo andando a gas, alguien me podría indicar cual puede ser la falla. Gracias. -
hace 3 años
Respuestas de la comunidad
Revisar masssa y alimentacion del sensor de antirrobo pasivo y salidas del ramal o conector a22 y a44 del pin ot de la ecu espero que te sirva saludos
hace 3 años
Mejor solución  (según MARIOARG, el autor del problema) 
 Ford Ecosport  2004 · 5 puertas,full,motor 1.6 · 177000 kms
Al pasar por un charco algo se moja y empieza a fallar que puede ser la falla se produse por mas que pase a baja velocidad por el charco
hace 3 años
y otras 2 personas con el mismo problema
Respuestas de la comunidad
Se moja las bobinas cambias bobinas cables y protejerlas del agua espero que te sirva saludos
hace 3 años
Mejor solución  (según carlos, el autor del problema) 
 Ford Ecosport  2005 · 2.0 · 159000 kms
Le cambie la bomba de agua y base del motor y ahora no enciende
hace 10 meses
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2010 · automatica · 77000 kms
Cunando acelero el motor silva como una polea patinando, el ruido suena al lado derecho del motor
hace un año
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2007 · 200000 kms
M podrian ayudar la camioneta se jalonea y prende el testigo alguien sabe cual es la falla??
hace 2 años
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2007 · 4 PUERTAS FULL MOTOR 2.0 · 160000 kms
Cuando giro todo el volante se apaga el motor, luego intento de nuevo y enciende sin problemas, pero tengo que doblar acelerando y con embrague a fondo para que no se apague...eso es todo
hace 2 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2011 · plus 1.6 · 68000 kms
Le cambio el aceite cuando corresponde,cada 10.000 km. y me consume 1.5 lt. Entre normal ?
hace 3 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2006
Yo ya vendi esa porqueria, compre un chevrolet s10 se nota mucho la diferencia esta es un avion el andar que tiene motor compren ford mucho marketing poca calidad.
usuario anónimoArgentina
hace 9 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2015 · Automática 2000cc · 5000 kms
El carro en menos de 2 mil revoluciones se le escucha un cascabeleo en el motor
hace un año
Respuestas de la comunidad
Tiene garantia de fabrica ,llevalo a la agencia, el cascabeleo lo ocasiona la gasolina de muy mala calidad. Compruebalo agregandole un aditivo que eleve el octanaje a la gasolina antes de llenar el tanque.
hace un año
Mejor solución  (según Elibeth, el autor del problema) 
Fijate que rpm recomiendan de minima en circulacion; en menos de 2000 teiende a hacer ese "cascabeleo de valvulas", aunque en un 2.0 creo que el tema pasa por lo que te aconseja Ricardo, aunque NO uses aditivos...cambia a una nafta de 98 octanos, de buena marca (Shell V-Power 98, en Argentina es la mejor y me soluciono el mismo problema...aunque es la mas cara)- Victor
hace un año
Mejor solución  (según Elibeth, el autor del problema) 
 Ford Ecosport  2010 · 128 kms
Quiero q alguien me diga sobre mi escoesport ultimamente cuando en ciudad y vajo la velocidad el cuenta vueltas q tiene q quedar en 1000 revoluciones se me baja a 500 o menos y se para aveces lo hace y aveces no alguien me podra esplicar q puede ser muchas gracias
hace 8 meses
Respuestas de la comunidad
Revisa la valvula iac (valvula de aceleracion minima) es la que regula el ralenti (rpm ) del motor para que no se apague, esta oculta detras del multiple de escape, se lava con limpiador de carburador en spray , si no mejora hay que cambiarla por otra original.
hace 8 meses
Mejor solución  (según martin, el autor del problema) 
 Ford Ecosport  2007 · 10000 kms
Hace un par de días que mi tablero se le encendió la imagen del Motor al correr a 180 km/h por pista y se ahogo y apago el motor y volvio a encender de ese tiempo para acá... al correr no mas de 80 Km/h en ocasiones se apaga el motor y vuelve a encender... y el indicador de gasolina marca en sentido contrario. ¿A que se deberá?

¡Por favor, ayuda!
-Saludos, desde Mexico.
hace 6 días
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2005 · 4 puertas motor 2.0 doble.arbol de elevas · 180000 kms
Hola que tal quisiera saber si alguno de ustedes sabe que motor más reciente le puedo poner a mi ecosport 2005 2.0 doble árbol lo que pasa es que estoy buscando el año más nuevo para que el motor me salga "mejor" que el del mismo año
hace un mes
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2010 · 115 kms
Buenos días,
Mi ford ecosport 2010 4x4, quema el fusible del motor de arranque, una vez lo cambio enciende la ando normal recorro hasta 200km. Y nuevamente lo quema.
hace un mes
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2005 · 5 puerta · 165000 kms
Al poner en marcha él motor en reposo un ruido dé tractor
hace 3 meses
y otras 3 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2004 · 1.6 · 159600 kms
Al tratar de encender el vehiculo, no funciona. La llave gira completa, pero el motor no parte, revisamos la bateria y el arranque estan bien, al igual que los niveles de aceite y agua, tratamos de hacerlo encender empujandolo en bajada pero se frena. Que puede ser? El motor?
hace 4 meses
y otras 4 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2005 · 130000 kms
Cada 15 días le ponía 1 litro de aceite. Y sé jaloneaba, la fuga era en el retén del motor y el jaloneo era un problema eléctrico derivado de los cables y la bobina los remplace y todo bien
hace 8 meses
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2015 · 15000 kms
Mi camioneta es una ecosport 2015 de 4 cilindros motor 2.0 en un transcurso de 40 kilometros de distancia a una velocidad de 100 a 115km/h me gasta alrededor de medio tanque de combustible. Yo no creo que sea algo normal por el kilometraje y el año. Se me hace que gasta mucha. Espero y alguien pueda darme una respuesta a este problema.
hace 8 meses
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2004 · motor 1.4 tdci · 340000 kms
Mi pregunta es... se adapta bien el motor de un ford fiesta kd 1.6 sigma a mi Eco Sport 2004 con motor diesel 1.4 tdci? muchas gracias
ignacio liprandiArgentina
hace 9 meses
y otra persona con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2013 · 1.6 · 100000 kms
Estaba llegando a mi casa y m salto motor averiado servicio inmediato no se q sera, la apague la prendi y no salto mas eso pero m dejo preocupado
hace 9 meses
y otras 3 personas con el mismo problema
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2007 · 4 puertas, diesel 1.4 · 140000 kms
Hola me paso lo mismo que a vos diego, el mecanico me informo que tengo que poner un motor nuevo, pero no lo consigo por ningún lado, me podrias aconsejar que hiciste para repararla o le pusiste un motor distinto, nadie me puede ayudar parece que le tienen miedo a estas camionetas. Saludos espero tu respuesta. Gracias
elizabeth 87Argentina
hace 2 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2005 · xlt 2.0 · 139000 kms
Hola, queria hacer dos consultas, 1) mi Ecosport al encender el aire ac. Y colocarlo en maximo de frio el motor comienza a andar de forma despareja como si fuera algo frenado, pero al liberarlo apagando el aire vuelve a quedar regulando. 2) al acelerar y soltar el acelerador permanece acelerado un escaso tiempo hasta que se estabiliza. Gracias.
hace 2 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2004 · 4 puertas full · 60000 kms
Solamente queria yo saber si para desmontar el motor le debo quitar el puente? o ¿debo sacarlo del bastidor?
hace 2 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2004 · ford.escor · 6000000 kms
Cuando el motor esta caliente funcionando bien empieza hacer contraexplociones asta que se detiene el motor y luego no arranca mas
hace 3 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2005
Cuando se pone a operar el clima cascabelea el motor
usuario anónimoMexico
hace 8 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2007 · xlt · 30000 kms
No se como tomarle el tiempo cuando se colocan las dos cadenas quien me puede ayudar
hace 3 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2005 · cinco puertas full motor 2:5  · 111000 kms
Cuando se revoluciona a sesenta km por hora parece que vibra se oye un ruido como si sumbaran las llantas ya revisaron baleros y no son la prueba es que falla tendrá
hace 3 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2005
La camioneta tiene no mas de 25.000 kmts y se le rompio el pedal del clutch. Tuvieron que cambiar el bombin, el disco, todo. Tardaron 15 dias en repararlo. Luego, cuando arreglaron eso, me dijeron que estaba rota la base del motor. El repuesto va a tardar 1 MES, porque el repuesto viene de Brasil!!!
usuario anónimoVenezuela
hace 9 años
Todavía no hay respuestas  ¿Por qué?
 Ford Ecosport  2013 · 1.6 SE · 40000 kms
Hola a todos! Me pasa los mismo que a otros de este foro y hoy es la 4° vez que la dejo en el concesionario. Por qué? Ando lo mas bien con el aire, luces de posición. Estaciono, prendo las balizas con motor en marcha y todo funcionando y arroja la leyenda de ABS!!! La apago y cuando la vuelvo a encender, parece que picanearan las agujas del tablero tipo electro shock; obviamente no arranca mas! Si te dan un empujon enciende al toque pero lo curioso es que, la batería y alternador cargan perfectamente, me han cambiado todas las mazas... En el cocesionario la deje hoy (nuevamente) y les pedi que…Leer completa
hace 2 años
y otras 17 personas con el mismo problema
Respuestas de la comunidad
Tengo una Eco 2.0 Tit 2014 y me pasa que me sale el cartel de ABS averiado y montón de alarmas más y no arranca. No más que enciendas la radio estando en contacto para que te deje a pata. Una cag...
hace 2 años
Mejor solución  (según Robert557, el autor del problema) 
Me paso lo mismo y me revisaron la bateria y ya no servia mas con un año de uso y listo el problema cambiandola ,porque el alternador carga pefecto
hace 2 años
Mejor solución  (según Robert557, el autor del problema) 
Hola soy Andres de barracas tengo una eco 2013 pero queda acelerada 1200 vueltas aveces baja de vueltas y a veces no el motor es el 1600 si alguno le paso algo parecido podria pasarme el dato gracias amigos fierreros---------------
hace 2 años
Mejor solución  (según Robert557, el autor del problema) 
Hola. Me pasó exactamente lo mismo, me dejó parada en el medio de la nada, sin si quiera poder cerrar las puertas. Le cambiaron la batería en la concesionaria oficial por una nueva. No pasaron 3 meses de eso. Hoy, voy a darle marcha, otra vez LO MISMO. Tuve que llamar para que vengan y carguen la bateria. No deje nada encendido, la uso regularmente... Estoy cansada. Cada dos por tres la tengo que llevar por algo.
hace 2 años
Mejor solución  (según Robert557, el autor del problema) 
Hola, tengo el mismo problema; marca falla con el ABS, luego se apaga el tablero y se queda sin direcciòn hidràulica y finalmente al parar no arranca màs. Le quiero dar arranca y las luces del tablero y las agujas estàn como poseìdas. La lleve a Dietrich; la 1º vez me dijeron que se descargo la baterìa pero no saben porque y alos 15 dìas me volviò a pasar lo mismo yendo por panamericana a 130 Km/h. Eso fue ayer y vuelta a Dietrich(Concesionario)
Estoy esperando que me digan si encuentran algo; serà problema de la computadora?
Ya he escuchado varios casos con lo mismo; se podrà hacer un reclamo a Ford?
Ayer volvì a perder un dìa de trabajo por este inconveniente
Luego comento que me dijeron, saludos
hace 2 años
Mejor solución  (según Robert557, el autor del problema) 
El mismo problema que comentan. Me dejo a pata un par de veces cambie la bateria y se soluciono un tiempo pero varias veces cuando quiero arrancar me tira falla abs como si no fuera a arrancar.
hace 2 años
Mejor solución  (según Robert557, el autor del problema)